WO 00/14240
PCT/EP99/06514
ATTENUATED SALMONELLA SPI2 MUTANTS AS ANTIGEN CARRIERS
Description
Background of the invention
In 1996, over 17 million people world-wide, mainly in developing countries,
were killed by various infections. The appearance and spread of antibiotic
resistances coupled with the increase in world-wide travel has led to an
increasing risk for the outbreak of pandemic infections. This possibility must
be taken very seriously since, for some pathogenic bacteria, the therapeutic
alternatives available have been reduced to a single option. Intriguingly,
pathogenic bacteria have also been discovered to be a relevant factor in
many chronic diseases. Stomach cancer, for example, is the second most
common cancer world-wide and is directly linked with chronic Helicobacter
pylori infections. Chlamydia pneumoniae has been detected in
arteriosclerotic plaques and recently this bacterium has been found in the
diseased regions of the brain of people suffering from Alzheimer's disease.
Many autoimmune diseases, such as rheumatoid arthritis, seem to have
bacterial origin. Borrelia burgdorferi is, in addition to many other bacteria,
a prominent example of an organism causing disease affecting increasing
numbers of people. Finally, Nanobacteria have been identified in the
chronically diseased kidneys of patients with crystalline deposits. Other
serious chronic diseases are caused by viral pathogens, the most clinically
relevant are Hepatitis B and C viruses (liver cancer) and the human
papilloma virus (cervical cancer).
The increasing clinical importance of bacterial pathogens has provoked
increased discussion regarding the paradigm of medicinal treatment or
WO 00/14240 PCT/EP99/06514
- 2 -
pr vention as the means to handle chronic diseases. Consistently, some
chronic diseases have been successfully cured by antibiotic treatment.
However, as indicated above, all micro-organisms are genetically capable
of rapidly generating progenies with adequate antibiotic resistances, thus
impeding efficient routine treatment. Conclusively, vaccines represent an
excellent alternative to pharmacological drugs, and, considering the financial
aspect that disease prevention is less cost-intensive than therapy, the
option of vaccination is even more attractive. Therefore, the therapeutic
vaccination approach has become particularly relevant, especially with
respect to the treatment of cancer and chronic bacterial or viral diseases.
The most frequently practised approach uses oral delivery of either
inactivated pathogens (dead vaccine) or parenteral injections of a defined
mixture of purified components (subunit vaccines). Most of the dead
vaccines are efficacious, however, the risk that the inactivation procedure
was incomplete and that the vaccinee may become infected remains a
problem. Furthermore, dead vaccines very often do not cover all genetic
variants that appear in nature. The subunit vaccines abolish most of the
disadvantages of the traditional dead vaccines. However, they require
technologically advanced antigen and adjuvant preparations, which makes
such vaccines relatively expensive. Furthermore, the subunit vaccines are
preferentially inoculated by the parenteral route, which is not the optimal
route for eliciting a broad immune response. In particular, the mucosal
branch of the immune system, which is the primary line of protection
against many pathogens, is strongly neglected by parenteral immunisations.
Another generation of vaccines is represented by live attenuated vaccines,
which are based on pathogenic bacteria or viruses that have been mutated
to apathogenic variants. These variants multiply in vivo for a limited period
of time before they are completely cleared by the host. Their limited
prevalence in the host tissue is sufficient to adequately provoke the host
immune system, which is then able to establish a protective immune
WO 00/1 4240 PCT/EP99/0651 4
- 3 -
response. From the safety aspect, live attenuated bacterial vaccines are
more favoured than live attenuated viral vaccines. Should a live bacterial
vaccine becomes threating for a vaccinee, the attenuated bacteria can
generally be controlled by antibiotic treatment. In contrast, live viral
vaccines, which use the replication apparatus of the host cell, are almost
impossible to control. Live bacterial vaccines are typically administered
orally and serve as excellent stimulators of the mucosal immune system.
Moreover, live bacterial vaccines are also good stimulators of the
systemically active immune system, namely the humoral and cellular
branches. Due to these excellent immuno-stimulatory characteristics, live
bacterial vaccine strains, such as Salmonella, are ideal carriers for
expressing antigens from a heterologous pathogen. Such bivalent (or
multivalent) vaccines mediate protection against two pathogens: the
pathogen homologous to the carrier as well as the pathogen whose
protective anttgen(s) are expressed by the carrier. Although no bivalent
bacterial vaccine expressing heterologous antigens is currently in use,
potential carriers currently under investigation include Bacille Calmette-
Guerin (BCG), Salmonella species, Vibrio cholerae and Escherichia co/i.
In the attenuation process, mutations are preferentially targeted to genes
that support the survival of the pathogen in the host. Initially, chemical
mutation regimes were applied to the Salmonella typhi strain Ty2, resulting
in what were thought to be perfectly attenuated pathogens capable of
mediating protective immunity, in contrast to the dead homologue.
However, subsequent large-scale clinical trails revealed that such strains
were still not sufficiently efficacious in the prevention of typhoid fever. It
appears that such strains were mutated in several genes, resulting in an
over-attenuation, which adversely affects the immunogenic potential of the
strain. Novel typhoid vaccine strains have been developed by the
introduction of genetically defined mutations. Most of these mutations have
been established in S. typhimurium. Infection with S. typhimurium causes
typhoid fever-like symptoms in mice and murine salmonellosis is a well
WO 00/1 4240 PCT/EP99/0651 4
- 4 -
accepted model for human typhoid. Such vaccine strains contain mutations
in proteins causing deficiencies in the biosynthesis of aromatic amino acids
[e.g. aroA, aroC and aroD) or purines (e.g. purA and purE), in the adenylate
cyclase gene (cya) or the cAMP receptor protein (crp), or possess mutations
affecting the regulation of several virulence factors (phoP and phoQ).
However, although a number of attenuated mutants have been generated
and characterised in the mouse model with regard to their role in virulence,
relatively few of them have been evaluated as vaccine carriers in humans.
The reason for this is that the mutants used are either still too virulent,
causing severe side effects in the host, or are not sufficiently immunogenic,
due to inadequate presentation to the immune system, which requires a
critical level of persistence of the vaccine strain in the host for activation.
A recent study revealed that the inactivation of individual Salmonella genes
causing attenuation of virulence directly influences the quality of an immune
response against the vaccine carrier strain. From this finding, one can
conclude that it might be possible to generate a variety of differently
attenuated Salmonella vaccine strains, each with a unique profile and
individual capabilities for eliciting an immune response. With this repertoire,
it might be possible to tailor a vaccine strain according to specific
immunological demands. As a logical consequence, one should also be able
to develop attenuated Salmonella vaccine strains for either prophylactic or
therapeutic purposes. However, the means by which such a representative
repertoire of Salmonella vaccine strains is obtained and further developed
into an efficacious vaccine must be determined.
In cases in which a Salmonella vaccine strain is used as a carrier for
heterologous antigens, additional parameters must be considered.
Traditionally, heterologous antigens have been expressed in the Salmonella
cytosol. In the mouse typhoid model, it was demonstrated that, when
heterologous antigens are expressed at high levels in the Salmonella
cytosol, inclusion bodies are often formed, which negatively influence the
WO 00/1 4240 PCT/EP99/0651 4
- 5 -
immunogenicity of the recombinant live vaccine strain in the vaccinated
host. It was concluded that the formation of inclusion bodies might be fatal
for the bacterium, further decreasing vitality and increasing attenuation, and
thus lowering the immunogenicity. Indeed, specific expression systems that
circumvent this secondary attenuation principle, e.g. the 2-phase regulated
expression system, can improve the efficacy of the presentation of
heterologous antigens to the host immune system.
It has been demonstrated that secretion of antigens by live attenuated
Salmonella can be superior to intracellular expression of the same antigens
both in eliciting protective T-cell responses (Hess et al., 1996; Hess et al.,
1997b) and in eliciting elevated levels of antigen-specific antibody
(Gentschev et al., 1998). Efficiencies of HlyA-directed secretion systems,
however, are usually low (30% or less of total synthesized antigen) (Hess
et al., 1 997a; Hess et al., 1 996), and the system seems to be problematical
in S. typhi for export of heterologous antigens (Orr et al., 1999).
A similar immunological profile is induced by the two type III secretion
systems, which are encoded by the Salmonella Pathogenicity Islands 1 and
2. These complex secretion machineries naturally deliver "effector proteins"
into the cytosol of the infected host cell, supporting the survival of the
pathogen within the host cell. By means of gene technology, the "effector
proteins" can be converted into carrier vehicles for epitopes from
heterologous antigens. Such chimeric "effector proteins" lose their virulent
character but retain their secretory character. Consequently, the chimeric
"effector protein" is delivered into the lumen of the host cell, where it is
appropriately processed and subsequently stimulates the cytotoxic branch
of the host immune system.
The most abundant protein secreted by Salmonella is flagellin (see, for
example (Hueck et al., 1995)). In S.typhimurium, flagellin occurs in two
allelic variants, FliC or FljB, while S. typhi carries only the FliC gene. Flagellin
WO 00/1 4240 PCT/EP99/0651 4
- 6 -
is secreted via the flagellum-specific export (FEX) pathway (Macnab, 1 996;
Minamino and Macnab, 1999), which is homologous to the type III
secretion pathway (Hueck, 1 998). It also has been shown recently that the
FEX pathway functions in secretion of non-flagella proteins in Yersinia
enterocolitica (Young et al., 1999). Like in type III secretion, the amino
terminus of FliC directs secretion. Thus, a truncated version of 183 amino
terminal amino acids of FliC (full length is 495 aa) is constitutively secreted
in large amounts (Kuwajima et al., 1989). In analogy to type III secretion,
the effective secretion signal in FliC may be as short as 10 to 20 amino
acids. The FliC or FljB secretion signals can potentially be used to secrete
large quantities of a heterologous protein which can serve as an antigen in
heterologous vaccination. It is likely that the amount of secreted antigen
can be even further increased in regulatory mutants affecting the expression
of flagella biosynthesis genes (Macnab, 1996; Schmitt et al., 1996) or by
using recombinant promoters to drive expression of the flagellin gene.
Secretion via the FEX pathway can allow the delivery of large amounts of
antigen into the Sa/monella-conta\ri\ng phagosome for early and efficient
antigen processing and antigen presentation to the host immune system.
Especially the MHC class II dependent branch of the host immune system
is strongly supported by the FEX pathway mediated antigen delivery.
The other known export machineries and surface display systems of Gram-
negative bacteria can be also applied to bacterial vaccine carriers such as
Salmonella. In general, a good immune response is achieved when the
antigen is presented on the Salmonella surface. However, as little is known
about the immunological consequence of such antigen presentation
systems, further experimental work is needed.
Additional immuno-modulatory effects can be achieved when
environmentally regulated Salmonella promoters are used for the expression
of heterologous antigens. For instance, the expression of a heterologous
WO 00/1 4240 PCT7EP99/065 ! 4
- 7 -
gene in a Salmonella carrier strain under control of the in vivo regulated
stress response htrA gene promoter resulted in a stronger immune response
than was obtained when under control of the anaerobically inducible
promoter of the nirB gene.
According to a first aspect, the present invention relates to an isolated
nucleic acid molecule comprising a nucleic acid sequence comprising at
least 50 nucleotides a) of the nucleic acid sequence of one of Figs. 21 A, B,
b) of an allele of the nucleic acid sequence of one of Figs. 21 A, B or c) of
a nucleic acid sequence which under stringent conditions hybridizes with
the nucleic acid sequence of one of Figs. 21 A, B.
Stringent hybridization conditions in the sense of the present invention are
defined as those described by Sambrook et aL, Molecular Cloning, A
Laboratory Manual, Cold Spring Harbor Laboratory Press (1989), 1.101-
1.104. According to this, hybridization under stringent conditions means
that a positive hybridization signal is still observed after washing for 1 hour
with 1 x SSC buffer and 0.1 % SDS at 55°C, preferably at 62°C and most
preferably at 68°C, in particular, for 1 hour in 0.2 x SSC buffer and 0.1 %
SDS at 55°C, preferably at 62°C and most preferably at 68°C.
In particular, the present invention relates to such a nucleic acid molecule
which comprises the complete coding regions or parts thereof of the genes
ssaD, ssaE, sseA, sseB, sscA, sseC, sseD, sseE, sscB, sseF, sseG, ssaG,
ssaH, ssaE, ssaJ, ssrA and ssrB. The invention pertains also to such nucleic
acids, wherein at least one coding region of said genes is functionally
deleted.
In one embodiment, the nucleic acid molecule comprises an insertion
cassette to facilitate the insertion of a heterologous nucleic acid molecule
by transposon or phage mediated mechanism.
WO 00/14240 PCT/EP99/06514
- 8 -
Furthermore, said nucleic acid molecules can comprise at least one
heterologous nucleic acid molecule. In this case the heterologous nucleic
acid molecule may be fused 5' or 3', inserted or deletion-inserted to the
inventive nucleic acid molecule. By the term "deletion-inserted" it is
understood that the insertion of the heterologous nucleic acid molecule is
associated with a concurrent deletion of parts of the inventive nucleic acid
molecule. Preferably, the nucleic acid molecule is inserted or deletion-
inserted and in one preferred embodiment the heterologous nucleic acid
molecule is flanked 5' and 3' by sequences of the nucleic acid molecule
according to the invention, wherein each of said sequences has a length of
at least 50 nucleotides, preferably 200-250 nucleotides.
Preferred, the heterologous nucleic acid molecule codes for a polypeptide
or peptide, more preferred it codes for a bacterial or viral antigen or a
homologue thereof or for a tumor antigen.
It is preferred that the nucleic acid molecule also comprises at least one
gene expression cassette to allow for efficient expression of the
heterologous nucleic acid molecule. Such gene expression cassette usually
comprises elements such as promoters and/or enhancers which improve the
expression of the heterologous nucleic molecule acids. Usually, such gene
expression cassette comprises elements for the termination of transcription.
The presence of transcription terminators, however, may be not preferred
in cases where the heterologous nucleic acid molecule is to be transcribed
together with other genes into a cistronic mRNA.
The nucleic acid molecule, one or more selective marker cassettes and one
or more transactivator cassettes and optionally invertase cassettes for
allowing the expression of the heterologous nucleic acid molecules in a one-
phase system or a two-phase system. Furthermore, sequences may be
present which code for a polypeptide or peptide-targeting domain and, thus,
allow for the targeting of the expression product of the heterologous nucleic
WO 00/1 4240 PCI7EP99/065 1 4
- 9 -
acid molecule to a predetermined cell compartment such as cytosol,
periplasma or outer membrane, or the secretion of said expression product,
or which code for an immunostimulatory domain.
According to another aspect, the invention relates to a recombinant vector
which comprises the nucleic acid molecule described above. Another aspect
of the invention pertains to a cell comprising a modified inventive nucleic
acid molecule as described above by insertion of a heterologous sequence
or the recombinant vector. The cell may be a prokaryotic cell such as a
gram-negative cell, e.g. a Salmonella cell, or it can be a eukaryotic cell such
as a mammalian cell, e.g. a human cell, and, in particular, a macrophage.
According to a still further aspect, the present invention relates to a peptide
or polypeptide comprising a peptide sequence comprising at least 20 amino
acids a) of the sequence of one of Figs. 23A-Q, or b) of a sequence which
is 60%, preferred 65% and more preferred 70% homologous to the
sequence of one of Figs. 23A-Q. In particular, the invention relates to a
polypeptide comprising the sequence a) of one of Figs. 23A-Q, or b) which
is 60%, preferred 65% and more preferred 70% homologous to the
sequence of one of Figs. 23A-Q.
Percent (%) homology are determined according to the following equation:
n
H = x 100
L
wherein H are % homology, L is the length of the basic sequence and n is
the number of nucleotide or amino acid differences of a sequence to the
given basic sequence.
Another aspect of the present invention relates to an antibody which is
directed against an epitope which is comprised of the aforementioned
peptide or polypeptide. The antibody may be polyclonal or monoclonal.
WO 00/1 4240 PCT/EP99/0651 4
- 10-
Methods for producing such an antibody are known to the person skilled in
the art.
A further aspect of the present invention relates to a fusion protein
comprising the polypeptide according to any one of the claims 17 and 18
having inserted or deletion-inserted or being fused C- or NH 2 -terminally with
at least one heterologous polypeptide. The heterologous polypeptide
preferred is an antigen, more preferred a bacterial or viral antigen or a tumor
antigen.
The present invention furthermore provides instructions for the development
of a variety of potential live Salmonella vaccine strains with different
attenuation levels, which subsequently serve as platforms for the
development of recombinant live Salmonella vaccine carrier strains that
express antigens from heterologous pathogens, thus serving as multivalent
vaccines. Such recombinant live Salmonella vaccine carriers are equipped
with modules comprising variable gene cassettes that regulate the
expression of heterologous antigens in Salmonella and determine
presentation of the heterologous antigens to the host immune system. By
combinations of both systems, differently attenuated live Salmonella
vaccine strains and variable gene cassettes, a variety of recombinant live
vaccine carrier strains can be generated that have, due to their variable
immunogenic characteristics, a broad application spectrum for both
prophylactic and therapeutic use. The basic attenuation principle originates
from novel mutations in the Salmonella Pathogenicity Island 2 (SPI2) gene
locus. Additional mutations, which can be used either alone or in
combination with mutations in sse or SPI-2 genes or in combination with
the aroA mutation for optimal attenuation of live vaccine carrier strains,
have been reported recently (Heithoff et aL, 1999; Valentine et al., 1998).
By combination of the individual mutations in the SPI-2 gene locus with
each other and with other known attenuating gene mutations, such as
aroA, etc., a broad repertoire of attenuation and immunogenicity can be
WO 00/1 4240 PCT/EP99/0651 4
- 11 -
achieved. Different expression cassettes can be introduced on these
platforms, allowing further modulation of the immune response directed
against the heterologous antigens. Finally, a library of individual
recombinant live Salmonella vaccine carrier strains is generated, covering
a broad spectrum of immuno-stimulatory potential, from which a genuine
live vaccine strain can be tailored for the optimal protection or treatment of
humans and/or animals against specific pathogens or disease.
Thus, in a further aspect, the present invention is an attenuated gram-
negative cell comprising the SPI2 gene locus, wherein at least one gene of
the SPI2 locus is inactivated, wherein said inactivation results in an
attenuation/reduction of virulence compared to the wild type of said cell-
Genes present in the Salmonella pathogenicity island 2 that encode for a
variety of proteins involved in type III secretion and those that are required
for systemic spread and survival within phagocytic cells are ideal candidates
for attenuation of pathogenic Salmonella ssp.
Several gram-negative bacterial pathogens secrete certain virulence proteins
via specialised type III secretion systems. Virulence factors enable
pathogenic bacteria to colonise a niche in the host despite specific attacks
of the immune system. The type III secretion systems comprise a large
number of proteins required to transfer specific effector proteins into
eukaryotic host cells in a contact-dependent manner, thus they have also
been called contact-dependent secretory systems. Although several
components of the secretion system apparatus show evolutionary and
functional conservation across bacterial species, the effector proteins are
less well conserved and have different functions. The Yersinia effectors
YpkA and YopH have threonine/serine kinase and tyrosine phosphatase
activities, respectively. The actions of these and other Yops inhibit bacterial
phagocytosis by host cells, which is thought to enable extracellular bacterial
proliferation. The Shigella Ipa proteins, secreted by the mxi/spa type III
WO 00/14240 PCT/EP99/06514
- 12 -
secretion system, promote entry of this bacterium into epithelial cells. EspA,
EspB and EspD, encoded by the locus of enterocyte effacement (LEE) of
enteropathogenic Escherichia coli (EPEC) are required for translocation of
proteins that cause cytoskeletal rearrangements and the formation of
pedestal-like structures on the host cell surface.
For the purposes of the present invention an "gram-negative celt comprising
the SPI2 gene locus" is a cell having a gene locus that harbors genes
required for the systemic spread and survival within phagocytic cells and,
thus, is a homologue or functional equivalent of the SPI2 locus from
Salmonella. Preferred, the inventive attenuated gram-negative cell is an
Enterobactericae cell, more preferred, a Salmonella cell, a Shigella cell or a
Vibrio cell. In general, cells having a broad host range are preferred. Typical
hosts are mammals, e.g. man, and birds, e.g. chicken. Salmonella cells are
more preferred, and particularly preferred is Salmonella serotype
typhimurium Definitive Type 104 (DT 104).
Salmonella typhimurium is unusual in that it contains two type III secretion
systems for virulence determinants. The first controls bacterial invasion of
epithelial cells, and is encoded by genes within a 40kb pathogenicity island
(SPI1). The other is encoded by genes within a second 40kb pathogenicity
island (SPI2) and is required for systemic growth of this pathogen within its
host. The genes located on pathogenicity island SPI1 are mainly responsible
for early steps of the infection process, the invasion of non-phagocytic host
cells by the bacterium. For most of the SPI1 genes, mutations result in a
reduced invasiveness in vitro. However, mutants that are defective in
invasion are not necessarily avirulent; studies in mice demonstrated that,
while these mutations in SPI1 genes significantly reduced virulence upon
delivery by the oral route, they had no influence on virulence following an
intraperitoneal route of infection. Taken together, these results indicate that
mutations in genes within the pathogenicity island SPI1 do not abolish
systemic infection and are therefore not very useful for the development of
WO 00/1 4240 PCT/EP99/0651 4
- 13 -
a safe, attenuated Salmonella carrier strain. In comparison, virulence studies
of SPI2 mutants have shown them to be attenuated by at least five orders
of magnitude compared with the wild-type strain after both oral and
intraperitoneal inoculation of mice.
Many of the genes encoding components of the SPI2 secretion system are
located in a 25kb segment of SPI2. SPI2 contains genes for a type III
secretion apparatus {ssa) and a two component regulatory system (ssr), as
well as candidate genes for a set of secreted effectors (sse) and their
specific chaperones (sse). On the basis of similarities with genes present in
other bacterial pathogens, the first 13 genes within the ssaK/U operon and
ssaJ encode components of the secretion system apparatus. A number of
additional genes, including ssaC (orf 11 in Shea ef al., 1996; spiA in
Ochman etaL, 1996) and ssrA (orf 1 2 in SheaefaA, 1996;sptf?in Ochman
et a/., 1 996), which encode a secretion system apparatus protein and a two
component regulatory protein, respectively, are found in a region
approximately 8kb from ssaJ.
Preferably, the inventive attenuated gram-negative cell has inactivated at
least one gene selected from effector (sse) gene secretion apparatus (ssa)
genes, chaperon (sse) genes and regulation (ssr) genes. More preferably,
the at least one inactivated gene is an sse, sse and/or ssr gene, even more
preferred is an sse and/or sse gene.
As far as the sse genes are affected by the inactivation, the inactivated
gene is preferably sseC, sseD, sseE or a combination thereof. As far as the
ssr genes are affected by the inactivation, preferably at least ssrB is
inactivated. As far as the sse genes are affected by the inactivation,
preferably at least sscB is inactivated.
The inactivation of said gene of the SPI2 locus (or functional homologue
thereof in cells other than Salmonella) is effected by a mutation which may
WO 00/14240 PCT/EP99/065I4
- 14 -
comprise deletion. Preferred are deletions of at least six nucleotides, and
more preferred is a deletion of the partial and, in particular, the complete
coding sequence for said gene. The mutation may also comprise the
insertion of a heterologous nucleic acid molecule into said gene to be
inactivated or a combination of deletion and insertion.
Pathogenic Salmonella ssp . serve a basis for the construction of a panel of
different live Salmonella vaccine prototypes generated by gradual
attenuations accomplished through the introduction of defined SPI2 gene
locus mutations. Each resulting individual live Salmonella vaccine prototype
is further transformed into a multivalent recombinant vaccine by the
introduction of exchangeable DNA modules carrying (1) genetically
engineered genes from heterologous pathogens and (2) adequate expression
systems executing efficacious antigen presentation to the host immune
system. In concert, these features elicit a specific immune response that
either protects vaccinated hosts against subsequently invading Salmonella
and/or other pathogens (prophylactic vaccination) or eliminates persistant
pathogens, such as Helicobacter pylori (therapeutic vaccination).
Pathogenic Salmonella ssp. are gradually attenuated by mutations in
individual virulence genes that are part of the SPI2 gene locus, e.g. an sse
gene coding for an effector protein, such as sseC, sseD or sseE, or an ssc
gene, such as sscB, coding for a chaperone, or an ssr gene, such as ssrB,
coding for a regulator. Individual mutation of each of these genes leads to
a unique individual grade of attenuation, which, in turn, effects a
characteristic immune response at the mucosal, humoral and cellular levels.
The individual grade of attenuation can be moderately increased by
combinations of at least two gene mutations within the SPI2 gene locus or
by combination with a mutation in another Salmonella gene known to
attenuate virulence, e.g. an aro gene, such as aroA. A stronger grade of
attenuation is achieved by mutation of a virulence gene that is part of a
polycistronic gene cluster encoding several virulence factors, such as the
WO 00/1 4240 PCT/EP99/0651 4
- 15 -
transcriptional unit comprising the sseC, sseD, sseE and sscB genes, such
that the mutation exerts a polar effect, disrupting expression of the
following genes. The grade of attenuation may directly depend on the
number of virulence genes that are affected by the polar mutation as well
as their individual characteristics. Finally, the strongest attenuation is
achieved when regulatory genes, such as ssrB, are mutated. Again, each
mode of attenuation of a Salmonella ssp. leads to the generation of a live
Salmonella vaccine strain that evokes an immune response at the mucosal,
humoral and cellular levels that is characteristic for the type and/or
combination of attenuating mutations present in that strain. The panel of
differently attenuated live Salmonella vaccine strains that is generated
represents a pool of potential carrier strains from which that carrier can be
selected that provokes the most efficacious immune response for either the
prevention or eradiction of disease in conjunction with the heterologous
antigens that are expressed.
Mutations leading to attenuation of the indicated Salmonella virulence genes
are preferentially introduced by recombinant DNA technology as defined
deletions that either completely delete the selected virulence gene or result
in a truncated gene encoding an inactive virulence factor. In both cases, the
mutation involves a single gene and does not affect expression of
neighbouring genes (non-polar mutation). An insertional mutation in one of
the indicated virulence genes is preferred when the selected gene is part of
a polycistronic virulence gene cluster and all of the following virulence
genes are included in the attenuation process (polar mutation). Insertional
mutations with non-polar effects are in general restricted to genes that are
either singly transcribed or are localised at the end of a polycistronic cluster,
such as ssrB. However, other attenuating mutations can arise
spontaneously, by chemical, energy or other forms of physical mutagenesis
or as a result of mating or other forms of genetic exchange.
WO 00/14240 PCT/EP99/06514
- 16 -
Thus, the mutation which results in the preparation of the inventive
attenuated gram-negative cell may be a polar or non-polar mutation.
Furthermore, the grade of attenuation may be modified by inactivating an
additional gene outside of the SPI2 locus, for example, another virulence
gene or a gene that is involved in the biosynthesis of a metabolite or a
precursor thereof such as the aro genes, in particular, aroA, or any other
suitable gene such as superoxide dismutase (SOD).
The attenuated cell according to the invention may furthermore comprise
elements which facilitate the detection of said cell and/or the expression of
an inserted heterologous nucleic acid molecule. An example of an element
which facilitates the detection of the attenuated cell is a selective marker
cassette, in particular, a selective marker cassette which is capable of
conferring antibiotic resistance to the cell. In one embodiment, the selective
marker cassette confers an antibotic resistance for an antibiotic which is not
used for therapy in a mammal. Examples of elements which facilitate the
expression of a heterologous nucleic acid molecule are a gene expression
cassette which may comprise one or more promoter, enhancer, optionally
transcription terminator or a combination thereof, a transactivator cassette,
an invertase cassette for 1 -phase or 2-phase expression of a heterologous
nucleic acid. An example of an element which facilitates the insertion of a
heterologous nucleic acid molecule is an insertion cassette.
In another aspect, the invention provides a carrier for the presentation of an
antigen to a host, which carrier is an attenuated gram-negative cell
according to any one of the claims 22 to 49, wherein said cell comprises
at least one heterologous nucleic acid molecule comprising a nucleic acid
sequence coding for said antigen, wherein said cell is capable of expressing
said nucleid acid molecule or capable of causing the expression of said
nucleic acid molecule in a target cell.
WO 00/1 4240 PCT/EP99/0651 4
- 17 -
Preferably, said nucleic acid molecules comprises a nucleic acid sequence
coding for a bacterial or viral antigen or for a tumor antigen. Examples of
bacterial antigens are antigens from Helicobacter pylori, Chlamydia
pneumoniae, Borrelia burgdorferi and Nanobacteria. Examples of viral
antigens are antigens from Hepatitis virus, e.g. Hepatitis B and C, human
papilloma virus and Herpes virus. The heterologous nucleic acid molecule
may comprise a nucleic acid sequence which codes for at least one
polypeptide or peptide-targeting domain and/or immunostimulatory domain.
Thus, the expression product of said heterologous nucleic acid molecule
may be targeted specifically to predetermined compartments such as
periplasms, outer membrane, etc. The heterologous nucleic acid molecule
may code for a fusion protein.
According to one embodiment the heterologous nucleic acid molecule is
inserted into the SPI2 locus, preferred, into an sse gene and, more
preferred, into sseC, sseD and/or sseE, in particular, sseC.
The insertion may be a polar insertion or an unpolar insertion. Generally, the
introduction of an unpolar insertion is preferred, since it allows for the
expression of the remaining genes of a polycistronic gene cluster, which
can be used for the generation of carriers having different grades of
attenuation.
Attenuated live Salmonella vaccines are used as carriers for specific
antigens from heterologous pathogens, e.g. Helicobacter, etc., thus acting
as a multivalent vaccine. The heterologous antigens are provided by a gene
expression cassette (GEO that is inserted by genetic engineering into the
genome of an attenuated Salmonella strain. Preferentially, insertion of the
gene expression cassette is targeted to one of the indicated virulence
genes, thereby causing an insertional mutation as described in previous
paragraph. In another application form, expression of the heterologous
genes in the gene expression cassette is regulated by trans-acting factors
WO 00/14240 PCT/EP99/06514
- 18 -
encoded by a trans-activator cassette (TC) or an invertase cassette
performing a 2-phase variable expression mode; Preferentially, the insertion
of the trans-activator cassette is targeted to a second chosen virulence
gene, which is then inactivated. Alternatively, the gene expression cassette
or the trans-activator cassette or the invertase cassette can be introduced
into the Salmonella genome by transposon-mediated insertion, which has
no attenuation effect.
The principles of genetic engineering are required to generate either deletion
or insertional mutations in Salmonella virulence genes. Generally, a suicide
plasmid carrying a mutated virulence gene cassette containing a selective
marker cassette (SMC) either alone or in combination with a gene
expression cassette or a trans-activator cassette or the invertase cassette
is introduced into the receptor Salmonella strain by conjugation. The original
virulence gene is replaced with the mutated virulence gene cassette via
homologous recombination, and the suicide plasmid, unable to replicate in
the Salmonella receptor strain, becomes rapidly depleted. Successfully
recombined Salmonella can be selected based on properties (such as, but
not limited to, antibiotic resistance) conferred by the product of the gene(s)
within the selective marker cassette. The mutated virulence gene cassette
comprises DNA sequences that are homologous to the genome of the
receptor Salmonella strain where the original virulence gene is localised. In
the case where the original virulence gene is to be completely deleted, only
those genomic DNA sequences that border the original virulence gene
(indicated as flanking regions) are included in the mutated virulence gene
cassette. The general architecture of a mutated virulence gene cassette
includes at each end a DNA sequence of at least 50 nucleotides, ideally 200
- 250 nucleotides, that is homologous to the genome segment where the
original virulence gene is localised. These DNA sequences flank a selective
marker cassette and the other cassettes, such as the gene expression
cassette (GEC) or the trans-activator cassette (TC) or the invertase
cassette. As indicated above, these cassettes are used to generate
WO 00/1 4240 PCT/EP99/0651 4
- 19 -
insertional mutations which disrupt original gene expression. For in-frame
deletions, a selective marker cassette is preferentially used.
The selective marker cassette (SMC) principally consists of a gene
mediating resistance to an antibioticum which is able to inactivate the
receptor Salmonella strain but which is actually not used in the treatment
of Salmonellosis. Alternatively, another selectable marker can be used. The
selective marker cassette is inserted in-frame in the targeted virulence gene
and, consequently, the expression of the marker gene is under the control
of the virulence gene promoter. Alternatively, the cassette is inserted within
a polycistronic transcriptional unit, in which case the marker gene is under
control of the promoter for this unit. In another application, the selective
marker gene is under control of its own promoter; in this case a
transcriptional terminator is included downstream of the gene. The selective
marker is needed to indicate the successful insertion of the mutated
virulence gene cassette into the genome of the receptor Salmonella strain.
Furthermore, the antibiotic resistance marker is needed to facilitate the pre-
clinical immunological assessment of the various attenuated Salmonella
strains. In another application form, the selective marker is flanked by direct
repeats, which, in the absence of selective pressure, lead to the
recombinatorial excision of the selective marker cassette from the genome,
leaving the short sequence of the direct repeat. Alternatively, the selective
marker cassette can be completely removed by recombinant DNA
technology. Firstly, the selective marker cassette is removed by adequate
restriction endonuclease from the original mutated virulence gene cassette
on the suicide plasmid leaving the flanking region sequences which are
homologous to the Salmonella genome. The suicide plasmid is then
transfered into the attenuated receptor Salmonella strain by conjugation
where the SMC-depleted mutated virulence gene cassette replaces the
SMC-carrying mutated virulence gene cassette by recombination. After
removal of the selective marker, the attenuated Salmonella strain is free for
WO 00/1 4240 PCT/EP99/0651 4
- 20-
the application in humans. Transcriptional terminator sequences are
generally included in the cassettes when polar mutations are established.
The gene expression cassette {GEO comprises elements that allow,
facilitate or improve the expression of a gene. In a functional mode the gene
expression cassette additionally comprises one or more gene expression
units derived from either complete genes from a heterologous source or
fragments thereof, with a minimal size of an epitope. Multiple gene
expression units are preferentially organised as a concatemeric structure.
The genes or gene fragments are further genetically engineered, such that
the resulting proteins or fusion proteins are expressed in the cytosol, in the
periplasm, surface displayed or secreted. Furthermore the genes or gene
fragments can be fused with DNA sequences encoding immunologically
reactive protein portions, e.g. cytokines or attenuated bacterial toxins. The
genes or gene fragments are either controlled in a one-phase mode from a
promoter within the gene expression cassette or in a 2-phase mode or
indirectly by a trans-activator cassette (TC). In the one-phase mode the
promoter is preferentially a Salmonella promoter that is activated, i.e.
induced, by environmental signals but also constitutive promoters of
different strength can be used. In the 2-phase mode, the expression of the
gene cassette is controlled by an invertase that derived from an invertase
cassette. The invertase catalyses the inversion of a DNA segment
comprising the gene cassette. The DNA segment is flanked on each end by
an inverted repeat which is the specific substrate for the invertase finally
causing two orientation of the gene cassette with respect to the gene
expression cassette promoter. In the ON-orientation the gene cassette is
correctly placed allowing transcription of the gene cassette. In OFF, the
orientation of the gene cassette is incorrect and no transcription occurs.
The invertase cassette comprises of an invertase that is controlled by a
constitutive promoter or a Salmonella promoter induced or derepressed by
environmental signals.
WO 00/1 4240 PCT/EP99/065 1 4
- 21 -
Heterologous antigens encoded within the gene expression cassette can be
expressed under the control of a promoter, e.g. a tissue-specific promoter,
which may be constitutive or inducible. The expression can be activated in
a target cell, whereby a signal is transmitted from the target cell to the
interior of the Salmonella cell, which signal induces the expression. The
target cell, for example, can be a macrophage. The expression product may
comprise a targeting domain or immunostimulatory domain, e.g. in the form
of a fusion protein. The heterologous protein itself also may be a fusion
protein. The heterologous antigens can be optionally expressed as cytosolic,
periplasmic, surface displayed or secretory proteins or fusion proteins in
order to achieve an efficacious immune response. The antigen encoding
sequences may be fused to accessory sequences that direct the proteins to
the periplasm or outer membrane of the Salmonella cell or into the
extracellular milieu. If the heterologous polypeptides are secreted, secretion
can occur using a type HI secretion system. Secretion by the SPI2 type III
secretion system is suitable. Proteins that are destined for the cytosolic
compartment of the Salmonella do not need accessory sequences, in this
case, naturally occurring accessory sequences must be removed from the
genes encoding such antigens.
The accessory sequences for the periplasmatic compartment of Salmonella
comprise a DNA sequence deduced from the amino-terminally localised
signal peptide of a heterologous protein naturally translocated via the
general secretion pathway, e.g. CtxA, etc.
The accessory sequences for the outer membrane compartment of
Salmonella preferentially comprise DNA sequences deduced from the
functionally relevant portions of a type IV secretory (autotransporter)
protein, e.g. AIDA or IgA protease. The appropriate fusion protein contains
an amino-terminally localised signal peptide and, at the carboxy-terminus,
a B-barrel shaped trans-membrane domain to which the foreign passenger
WO 00/14240 PCT/EP99/06514
- 22 -
protein is coupled via a spacer that anchors the passenger protein to the
bacterial surface.
The accessory sequences for secretion into the extracellular milieu comprise
DNA sequences deduced from proteins naturally secreted by the type III
secretion system. In a generally functional fusion protein, the heterologous
antigen is fused in the centre of a protein naturally secreted by the type III
pathway or at the carboxy-terminal end of the respective protein.
The transactivator cassettes (TC) provide activators which generally
improve expression of the heterologous antigens encoded by the various
gene expression cassettes. Such activators either directly (RN A polymerase)
or indirectly (transcriptional activator) act on the transcription level in a
highly specific order. Preferentially, the expression of such activators are
controlled by Salmonella promoters which are induced in vivo by
environmental signals. In another application form the synthesis of the
activator within the transactivator cassette is regulated in a 2-phase mode.
The invertase expressed by the invertase cassette places the activator
encoding DNA fragment in two orientations with respect to the
transcriptional promoter. In the ON-orientation the activator gene is in the
correct transcriptional order. In the OFF-modus the activator is incorrectly
orientated and no expression occurs.
In the simple system, the gene product of the transactivator cassette exerts
its effect directly on the promoter present in the gene expression cassette,
directly activating or de-repressing expression of the heterologous gene. In
the complex system, activation of the promoter in the heterologous gene
expression cassette is dependent upon two or more interacting factors, at
least one of which (encoded in the transactivator cassette ) may be
regulated by external signals. Further complexity is found in cascade
systems, in which the external signal does not directly exert its effect on
the transactivator cassette , but rather through a multi-step process, or in
WO 00/1 4240 PCT/EP99/0651 4
- 23 -
which the gene product of the transactivator cassette does not directly
exert its effect on the heterologous gene expression cassette , but rather
through a multi-step process.
According to still another aspect, the present invention is an attenuated
gram-negative cell comprising the SPI2 gene locus, characterized by a lack
of at least one SPI2 polypeptide, wherein said lack results in an
attenuation/reduction of virulence compared to the wild type of said cell.
Preferably, said missing SPI2 polypeptide is one or more effector
polypeptide, secretion apparatus polypeptide, chaperon polypeptide or
regulatory polypeptide. Furthermore, said attenuated cell may be a carrier
which then is characterized by the presence of at least one heterologous
peptide or polypeptide having immunogenic properties.
A further aspect of the present invention is a pharmaceutical composition
which comprises as an active agent an immunologically protective living
vaccine which is an attenuated gram-negative cell or carrier according to
the invention. The pharmaceutical composition will comprise additives such
as pharmaceutical^ acceptable diluents, carriers and/or adjuvants. These
additives are known to the person skilled in the art. Usually, the
composition will administered to a patient via a mucosa surface or via or via
the parenteral route.
Further aspects of the present invention include a method for the
preparation of a living vaccine, which comprises providing a living gram-
negative cell comprising the SPI2 locus and inactivating at least one gene
of the SPI2 locus to obtain an attenuated gram-negative cell of the
invention, and optionally inserting at least one heterologous nucleic acid
molecule coding for an antigen to obtain a carrier according to the
invention. A further aspect pertains to a method for the preparation of a
living vaccine composition comprising formulating an attenuated cell or a
carrier according to the invention in a pharmaceutically effective amount
WO 00/1 4240 PCT/EP99/0651 4
- 24 -
together with pharmaceutical^ acceptable diluents, carriers and/or
adjuvants. A further aspect of the invention relates to a method for the
detection of an attenuated cell or a carrier according to the invention,
comprising providing a sample containing said cell and detecting a specific
property not present in a wild type cell. Methods for detecting a specific
property of the attenuated cell or carrier, which is not present in wild type,
are known to the person skilled in the art. For example, if this specific
property of the attenuated cell comprises a deletion of one or more parts of
the SPI2 locus, then the presence of said cell can be detected by providing
a pair of specific primers which are complementary to sequences flanking
this deletion and amplifying a fragment of specific length using amplification
methods such as PCR. Methods for detecting the presence of an inventive
carrier comprise PCR amplification of an inserted fragment or a fragment
spanning the insertion boundary, hybridization methods or the detection of
the heterologous expression product or of a selective marker.
A further aspect of the invention is a method for establishing a library of
attenuated gram-negative cells or carriers, respectively, according to the
invention. The method comprises the preparation of attenuated recombinant
vaccine strains, each having a different mutation in the SPI2 locus which
results in a different degree of attenuation. The pathogenicity or virulence
potential of said strains can then be determined using known methods such
as determination of the LD50, and the strains are rated according to the
different pathogenicities, i.e. a different grade of attenuation. Preferably, the
method comprises also the determination of other parameters of interest
such as the immunogenicity or the immuno-stimulatory response raised in
a host. Methods for determining the immuno-stimulatory potential are
known to the person skilled in the art and some of them are described in
Example 6. Preferably, the immuno-stimulatory potential of the inventive
attenuated cells or carriers is determined at humoral, cellular and/or mucosal
level. In this way it is possible to establish a library of attenuated cells or
carriers having a predetermined attenuation degree and predetermined
WO 00/1 4240 PCT/EP99/0651 4
- 25 -
immuno-stimulatory properties. Thus, for each application, the strain having
the desired properties can be selected specifically. For example, it will be
usually preferred to select a strong attenuated strain for administration to
patients which receive immunosuppressive drugs.
In a similar way, the invention allows for the establishment of libraries of
attenuated carriers having defined pathogenicities and optionally
immunogenicities. The establishment of a carrier library additionally will
comprise the determination of the antigen presentation of said carrier strains
to a host, whereby a panel of different carriers strains will be obtained
having defined properties with respect to pathogenicity, immuno-stimulatory
potential of carrier antigens and immuno-stimulatory potential of the
heterologous antigen.
Another aspect of the invention is the use of the attenuated cell or carrier
according to the invention for the preparation of a drug for the preventive
or therapeutic treatment of an acute or chronic disease caused essentially
by a bacterium or virus. For example, for the prevention or treatment of a
Salmonella infection one will administer an attenuated Salmonella cell to
raise the immune response of an affected patient. Similarly, a carrier
according to the invention may be used for the preparation of a drug for the
preventive or therapeutic treatment of a tumor.
The individual immuno-protective potential of each of the established
recombinant Salmonella vaccine strains is determined in a mouse model
using a pathogenic Salmonella typhimurium as the challenge strain.
Determination of the virulence potential of the recombinant
Salmonella vaccine strain: (1) Competitive index or LD50; (2)
Systemic prevalence in blood, liver and spleen strictly excluded.
Determination of the immuno-stimulatory potential of the carrier
strain with a cytosolically expressed heterologous test antigen: (1)
WO 00/1 4240 PCT/EP99/0651 4
- 26 -
Single oral immunisation and subsequent evaluation of the short- and
long-term immune response: (a) analysis of the humoral immune
response profile, (b) analysis of the mucosal immune response
profile, (c) analysis of the cellular immune response profile; (2)
Multiple oral immunisations and subsequent evaluation of the short-
and long-term immune response: (a) analysis of the humoral immune
response profile, (b) analysis of the mucosal immune response
profile, (c) analysis of the cellular immune response profile.
Determination of the immuno-stimulatory potential of the carrier
strain for the delivery of heterologous DNA (DNA vaccination).
Preferentially, the Salmonella acceptor strain has a broad host range,
exhibiting significant pathogenicity in both animals and humans. Ideally, this
is a Salmonella strain that is strongly pathogenic for mice, such as S.
typhimurium. After successful development of the recombinant Salmonella
vaccine strain, the strain is directly applicable for use in both animals and
humans. If such an ideal Salmonella acceptor strain is not satisfactory for
the respective host, other host-specific Salmonella must be selected, such
as S. typhi for humans.
Other aspects of the invention relate to the use of a nucleic acid molecule
as shown in Fig. 21 A or B or one of the Figs.22A-Q, optionally modified as
described hereinabove or of a vector as described hereinabove for the
preparation of an attenuated cell, a living vaccine or a carrier for the
presentation of an antigen to a host and to the use of the Salmonella SPI2
locus for the preparation of an attenuated cell, a living vaccine or preferably
a carrier for the presentation of an antigen to a host. In this context the
term "Salmonella SPI2 locus" refers to any nucleic acid sequence, coding
or not coding, and to the expression product of coding sequences.
WO 00/1 4240 PCT/EP99/0651 4
- 27 -
A still further aspect of the present invention is the use of a virulence gene
locus of a gram-negative cell for the preparation of a carrier for the
presentation of an antigen to a host.
Another aspect of the invention relates to a method of therapeutically or
prophylactically vaccinating an animal, e.g. a mammal, e.g. a human,
against a chronic disease caused primarily by a infectious organism
including preparation and administering a vaccine of the invention.
Still another aspect of the present invention is an isolated nucleic acid
molecule comprising a nucleic acid of at least 100 nucleotides a) of the
nucleic acid sequence of one of Figs.24A, B f b) of a nucleic acid sequence
which under stringent conditions hybridizes with the nucleic acid sequence
of one of Figs.24A, B.
In particular, said aspect relates to said nucleic acid molecule which is
capable of inducing the expression of a nucleic acid sequence conding for
a peptide or polypeptide operatively linked to said nucleic acid molecule.
The in vivo inducible promoter Pivi comprises a DNA fragment which carries
sequences for an operator and a transcriptional promoter. Such in vivo
inducible promoter can be identified by applying an adequate reporter gene
approach. Two of such in vivo inducible promoters have been identified
within the SPI2 locus which initiate expression of the ssaBCDE operon
(promoter A2) and the sseABsscAsseCDEsscBsseFG operon (promoter B),
respectively. These promoters are induced by a regulative system
comprising the ssrA and ssrB gene products. This regulative system is part
of the SPI2 locus responsible for the activation of additional SPI2 locus
genes. The regulative system is activated in macrophages by environmental
WO 00/1 4240 PCT/EP99/065 1 4
- 28 -
signal(s) via sensor protein SsrA. The SsrB protein finally binds at a defined
DNA sequence which initiates transcription through the RNA polymerase.
In an application form the DNA fragment comprising operator/promoter
sequences is inserted in front of an invertase gene or an activator gene or
a gene expression cassette, thereby executing an in vivo inducible
expression in bacteria carrying at least the ssrA and ssrB genes or the
complete SPI2 locus.
Thus, in a further aspect, the invention relates to an expression system for
the in vivo inducible expression of a heterologous nucleic acid in a target
cell, comprising a carrier cell for said heterologous nucleic acid, wherein
said carrier cell comprises (a) a polypeptide having the amino acid sequence
shown in Fig.23P (ssrA) or a functional homologue thereof, (b) a
polypeptide having the amino acid sequence shown in Fig.23Q (ssrB) or a
functional homologue thereof, and (c) the nucleic acid molecule of one of
Figs.24A, B or a functional homologue thereof, as described above.
The target cell may be any suitable cell but preferably it is a macrophage.
The carrier cell preferably is a Salmonella cell. The target cell may also
comprise one or more of the elements described above such as selective
marker cassettes, gene expression cassettes, transactivator cassettes,
invertase cassettes and/or insertion cassettes. Furthermore, it may comprise
a heterologous nucleic acid, in particular, the heterologous nucleic acids
may be inserted into a gene expression cassette, thus rendering the GEC
functional.
A still further aspect of the invention relates to the use of a nucleic acid
molecule comprising at least 100 nucleotides of the nucleic acid sequence
WO 00/1 4240 PCT/EP99/0651 4
- 29 -
shown in one of Figs.24A, B or hybridizing therewith and having promoter
activity, for the in vivo inducible expression of a heterologous nucleic acid
molecule.
A further aspect of the present invention is the use of said nucleic acid
molecule for the detection of in vivo inducible promoters.
Experimental Procedures
The strains, material, and methods used in the type III secretion system of
the Salmonella Pathogenicity Island 2 (SPI2) work described above are as
follows:
Mice
Female BALB/c (H-2 d ) of 6-12 weeks of age were maintained under
standard conditions according to institutional guidelines. This study was
approved by an ethic committee for animal use in experimental research.
Bacterial strains, phages and plasmids
The bacterial strains, phages and plasmids used in this study are listed in
Table 1. Unless otherwise indicated, bacteria were grown at 37°C in Luria
Bertani (LB) broth or agar, supplemented with ampicillin (50 /yg/ml),
kanamycin (50//g/ml), or chloramphenicol {50 /vg/ml) where appropriate.
Eukaryotic cells were grown in RPMI 1640 supplemented with 10% of
WO 00/14240
PCT/EP99/06514
- 30 -
foetal calf serum (FCS), 100 U/ml penicillin, 50/yg/ml streptomycin, 5x1 0 5
M 2-mercaptoethanol and 1 mM L-glutamine (GIBCO BRL; Prisley,
Scotland). To achieve constitutive expression of R-gal, the plasmid pAH97
(Holtel etaL, 1 992) was electroporated into the carrier strains as described
elsewhere (O'Callaghan and Charbit, 1990).
Table 1 . Phages, piasmids and bacterial strains used in this work.
Phage, plasmid
or strain
Description
Reference
Phages
XI
X2
X5
Piasmids
pBluescriptKS+,
pBluescriptSK+
pUC18
pT7-Blue
clone from a library of S. typhimurium
genomic DNA in XI 059
clone from a library of S. typhimurium
genomic DNA in XI 059
clone from a library of S. typhimurium
genomic DNA in XI 059
"""* /
Amp*; high copy number cloning vectors
Amp F ; high copy number cloning vector
Amp'; high copy number cloning vector
Shea et al, 1996
Shea et al, 1996
Shea et al. y 1996
Stratagene,
Heidelberg
Gibco-BRL,
Eggenstein
Novagen,
Heidelberg
WO 00/14240
PCT/EP99/06514
- 31 -
10
15
20
pCVD442
pACYC184
pGPLOl
pLB02
pGP704
pKAS32
pNQ705
pSB315
pl-6
pi -20
pl-21
pi -22
p2-2
P 2-20
p2-21
p2-22
p2-50
p5-2
p5-30
p5-31
suicide vector
r r
Cm ,Tet ; low copy number cloning vector
R6K ori, Amp ; A./?/r-dependent
suicide vector for luc fusions
R6K ori, Amp r ; Xp/r-dependent
suicide vector for luc fusions
R6K ori, Amp F ; A./?/r-dependent
suicide vector
Amp 1 ; A/>/r-dependent suicide vector;
rpsf
R6K ori, Cm 1 ; Ajp/r-dependent suicide vector
r r
Kan , Amp
Amp r , 4.8kb Pstl/BamUl fragment of A,l in
pT7-Blue
L7kb BamHM Hindi fragment of pl-6 in pKS+
aphT cassette in EcoKV site of pi -20
XbaVKpnl insert of pl-21 in pKAS32
Amp r , 5,7kb BamUl fragment of X2 in pUC18
1.6kb HindUll Hindi fragment of p2-2
in //mdlll/Smal-digested pKS+
aphT cassette in Hindi site of p2-20
insert of p2-21 in pKAS32
3.7kb BamYlMKpnl fragment of p2-2 in pKS+
Amp F ; 5.7kb EcoKl fragment of X5 in pKS+
3.0kb PstUEtoR] fragment ofp5-2 in pUC18
aphT cassette in EcaRV site of pS-30
Donnenberg et al M
1991
Chang and
Cohen, 1978
Gunn and Miller,
1996
Gunn and Miller,
1996
Miller and
Mekalanos, 1988
Skorupski and
Taylor, 1996
Forsberg et aL>
1994
Galan et aL y 1992
this work
this work
this work
this work
this work
this work
this work
this work
this work
this work
this work
this work
WO 00/14240
PCT/EP99/06514
- 32 -
p5-33 SphlAEcoRl insert of p5-31 in pGP704 this work
p5-4 Amp F ; 5.8kb HindlU fragment of X5 in pSK+ this work
p5-40 4.5kb SstI///wdIII fragment of p5-2 in pKS+ this work
p5-41 aphT cassette in Smal site of p5-40 this work
p5-43 KpnllSstl insert of p5-41 in pNQ705 this work
p5-5 Amp F ; Pst\ digestion of p5-4 and religation this work
of the larger fragment
p5-50 2.6kb BamHl/Clal fragment of p5-2 in pKS+ this work
p5-51 aphT cassette in Hindlll site of p5-50 after this work
Klenow fill-in
p5-53 XbaVSaR insert of p5-51 in pGP704 this work
p5-60 Cla\ -digestion of p5-2 and religation of larger this work
fragment
p5-8 Amp r , 2.2kb Pstl/Hmdlll fragment of this work
p5-2 in pSK+
psseA Cm ; sseA in pACYC184 this study
psseB Cm; sseB in pACYC184 this study
psseC Cm; sseC in pACYC184 this work
E. coli strains
DH5a
S17-1 Xpir
CC118 Xpir
XL 1 -Blue
see reference
Xpir phage Iysogen (see reference)
Xpir phage Iysogen (see reference)
see reference
Gibco-BRL
Miller and
Mekalanos, 1988
Herrero ct al., 1990
Stratagene
WO 00/14240
PCT7EP99/06514
- 33 -
S. typhimurium
strains
NCTC 12023
CS015
CS022
P2D6
P3F4
P4H2
P6E11
P8G12
P9B6
P9B7
P11D10
NPssaV
HH100
HH101
HH102
HH103
HH107
HH108
MvP102
MvP103
MvP103[pxveC]
MvPl31
MvP127
MvP239
MvP244
wild-type
phoP- 1 02 : :Tni Od-Cm
phoP
ssaV::mTn5
ssrA::mTn5
hilA::mTn5
spaRS::mTn5
ssrB::mTn5
ssaV::mTn5
ssaT::mTn5
ssaJ::mTn5
ssaV::aphT f Km r ; non-polar mutation
sseAA:::aphT, Kn/; non-polar mutation
HH100 containing psseA
sseBA:::aphT, Km r ; non-polar mutation
HH102 containing psseB
sseFA:::aphT, Km ; non-polar mutation
sseG::aphT 9 Kn/; non-polar mutation
AsseEsscBy Km'; non-polar mutation
sseCv.aphT, Kn/; non-polar mutation
MvP103 containing psseC
ssaBr.luc in S. typhimurium NCTC 12023
sseA .'.luc in S. typhimurium NCTC 12023
sipC'.'JacZY, EE638 in S. typhimurium
NCTC 12023
ssaB::luc in S. typhimurium P8G12
Colindale, UK
Miller et aL, 1989
Miller et aL, 1989
Shea et aL, 1996
Shea et aL, 1996
Monack et aL, 1996
Shea et aL, 1996
Shea et aL, 1996
Shea et aL, 1996
Shea et aL, 1996
Shea et aL, 1996
Deiwick et aL, 1998
this study
this study
this study
this study
this study
this study
this work
this work
this work
this work
this work
Hueck et aL, 1995;
this work
ihis work
WO 00/14240
PCT/EP99/06514
- 34 -
MvP266
ssaHr.luc in S. typhimurium NCTC 12023
this work
MvP284
ssr A:\aphT, Rn/; non-polar mutation
this work
IVlVr j/U
ooiij ..lAjjm , iviii , iiuii~jjvjiar rnuiaxion
this work
MvP337
in-frame deletion in sseC
this work
MvP338
in-frame deletion in sseD
this work
MvP339
in-frame deletion in sscB
this work
MvP340
in-frame deletion in ssrA
this work
SL7207
S. typhimurium 2337-65 hisG46 y
gift from
DEL407 aroA ::Tn/(Tc-s)
B.A.D. Stocker
111-57 sseC
A sseC
this work
Example 1 : Distribution of the pathogenicity island SPI-2 within different Salmonella
strains
The presence of open reading frames of the SPI-2 region in various Salmonella
isolates and E. coli K-12 was analyzed by Southern hybridization as shown in Table
2.
Table 2: Prevalence of SPI-2 genes in various Salmonella ssp. deduced from
representative gene probes
Species
S. enterica
S. enterica
S. enterica
S. enterica
S. enterica
S. enterica
S. enterica
S. enterica
S. bongori
S. bongori
E. coli K-12
subspec.
I
I
II
Ilia
Illb
IV
VI
VII
serovar/serotype
typhimurium
typhi
66:z4i:~
44:z48>-
ssrAB
+
+
+
+
+
ORF
+
+
+
+
+
+
+
+
+
Presence or absence of hybridizing bands is indicated by + or respectively.
WO 00/14240
- 35 -
PCT/EP99/06514
Hybridization
Genomic DNA of various Salmonella strains and E. coli K-1 2 was prepared
as previously described {Hensel et al. t 1997a). For Southern hybridization
analysis, genomic DNA was digested with EcoH\ or EcoRV, fractionated on
0.6 % agarose gels and transferred to Hybond N + membranes (Amersham,
Braunschweig). Various probes corresponding to the SPI-2 region were
obtained as restriction fragments of the subcloned insert of A1 . Probes
corresponding to ORF 242 and ORF 319 were generated by PCR using
primer sets D89 (5'-TTTTTACGTGAAGCGGGGTG-3') and D90 (5'-
GGCATTAGCGGATGTCTGACTG-3') , and D9 1 (5'-
CACCAGGAACCATTTTCTCTGG-3') and D92 ( 5 '-
CAGCGATGACGATATTCGACAAG-3'), respectively. PCR was performed
according to the specifications of the manufacturer (Perkin-EImer,
Weiterstadt). PCR products were submitted to agarose gel electrophoresis
and fragments of the expected size were recovered and purified.
Hybridization probes were labeled using the DIG labeling system as
described by the manufacturer (Boehringer, Mannheim).
Example 2 : Characterization of sse genes and construction of sseC::aphT,
sseD::aphT and sseEA mutant S. typhimurium strains MvP103, MvP101
and MvP102
Organization of sse and ssc genes
In order to characterize SPI2 genetically and functionally, a central region
of the pathogenicity island (Fig. 1 A) has been cloned and sequenced. DNA
fragments covering the region between ssaC and ssaJ were subcloned in
plasmids p5-2 and p5-4 as indicated in Fig. 1C. The arrangement and
designation of genes in the 8kb region between ssaC and ssaK is shown in
Fig. IB. This sequence will be available from the EMBL database under
WO 00/1 4240 PCT/EP99/0651 4
- 36 -
accession number AJ224892 in the near future. The sequenced region
extends the open reading frame (ORF) of a gene encoding a putative subunit
of the type til secretion apparatus referred to assp/J3(Ochman era/., 1 996).
For consistency with the universal nomenclature for type III secretion
system subunits (Bogdanove et aL, 1996) and the nomenclature of other
SPI2 genes (Hensel et aL, 1 997b), this gene has been designated ssaD. The
deduced amino acid sequence of ssaD is 24% identical to YscD of Y.
enterocolitica. This is followed by an ORF with coding capacity for a 9.3
kDa protein, 34% identical to YscE of Y. enterocolitica. Therefore, this gene
is designated ssaE. A sequence of 263 bp separates ssaE and a set of nine
genes, several of which encode proteins with sequence similarity to
secreted effector proteins or their chaperones from other pathogens. These
genes are separated by short intergenic regions or have overlapping reading
frames and it is likely that some are co-transcribed and translationally
coupled. Therefore, the genes with similarity to those encoding chaperones
were designated sscA and sscB, and the others sseA-E. The amino acid
sequence deduced from sscA shows 26% identity/49% similarity over 1 58
amino acid residues to SycD, the product of IcrH of Y. pseudotuberculosis
which acts as a secretion-specific chaperone for YopB and YopD (Wattiau
et aL. 1994). The amino acid sequence deduced from sscB shows 23%
identity/36% similarity over 98 amino acid residues to Ippl of Shigella
flexneri, Ippl is a chaperone for S. flexneri invasion proteins (Ipas) (Baundry
et aL, 1988). As is the case for the secretion chaperones SycD, Ippl and
SicA (Kaniga et aL, 1995), SscB has an acidic pi (Table 3), whereas SscA
has an unusually high pi of 8.8. SseB is 25% identical/47% similar to EspA
of EPEC over the entire length of the 192 amino acid residue protein (Fig.
2b). SseD is 27% identical/51% similar to EspB of EPEC over 166 amino
acid residues. SseC has sequence similarity to a class of effector proteins
involved in the translocation of other effectors into the target host cell.
These include YopB of Y. enterocolitica, EspD of EPEC and PepB of
Pseudomonas aerugunosa. SseC is approximately 24% identical/48%
similar to both EspD of EPEC and YopB of Y. enterocolitica (Fig. 2a). EspD
WO 00/1 4240 PCT7EP99/0651 4
- 37 -
and YopB have two hydrophobic domains that are predicted to insert into
target cell membranes (Pallen et a/., 1997). SseC contains three
hydrophobic regions that could represent membrane-spanning domains.
Other features of these predicted effector proteins are shown in Table 1 .
Using the TMpredict program (Hofmann and Stoffel, 1 993), transmembrane
helices are predicted for all the effector proteins apart from SseA which is
very hydrophilic. Alignments of SseC to homologs in other pathogens are
shown in Fig. 2b. Conserved amino acids are mainly clustered in the
central, more hydrophobic portion of the protein, but unlike YopB, there is
no significant similarity to the RTX family of toxins. The conserved residues
in SseD are present mainly in the N-terminal half of the protein. Comparison
of the deduced amino acid sequences of sseABCDEF with entries in the
PROSITE database did not reveal the presence of any characteristic protein
motifs. We subjected the predicted amino acid sequences of the sse genes
to searches using the programs COIL and MULTICOIL as described by Pallen
et aL (1997). SseA and SseD are predicted to have one trimeric coil each,
and SseC is predicted to have two trimeric coils (Table 3). Since EspB and
EspD are predicted to have one and two trimeric coils, respectively (Pallen
et aL, 1997), this provides further evidence that these proteins are
functionally related.
Table 3. Features of predicted proteins.
Protein
M, (kDa)
Pi
Tm predictions
Predicted coils
SseA
I2.5
9.3
hydrophilic
at least one (trimer)
SseB
21.5
4.7
one transmembrane helix
none
SseC
52.8
6.3
three transmembrane helices
at least two (trimers)
SseD
20.6
4.8
three transmembrane helices
at least one (trimer)
SseE
16.3
9.7
one transmembrane helix
none
SseA
18.1
8.8
hydrophilic
none
Sscli
16.4
4.7
hydrophilic
none
WO 00/14240
Expression of SPI2 genes
- 38 -
PCT/EP99/06514
Generation of antibodies against recombinant SPI2 proteins
In order to monitor the expression of the SPI2 genes sseB, sscA and ssaP,
a Western blot analysis of total bacterial cells with polyclonal antibodies
raised against recombinant SPI2 proteins SseB, SscA, and SsaP was
performed.
Protein gel electrophoresis and Western blotting were performed as
described elsewhere (Laemmli, 1 970 and Sambrook eta/., 1 989). Plasmids
for the expression of recombinant SPI2 protein were constructed by cloning
the individual SPI2 genes in plasmids pQE30, pQE31 or pQE32 (Qiagen,
Hilden) in order to generate in-frame fusion to the N-terminal 6His tag.
Recombinant SPI2 genes were expressed in £. co/i M1 5 IpREP] (Qiagen) and
purified by metal chelating chromotography according to recommendations
of the manufacturer (Qiagen). For immunisation, about 1 mg of recombinant
SPI2 proteins were emulsified with complete and incomplete Freund's
adjuvant for primary and booster immunizations, respectively. Rabbits were
immunized subcutaneously according to standard protocols (Harlow and
Lane, 1988). SPI2 proteins were detected with antisera raised against
recombinant SPI2 proteins after electrophoretical separation of proteins
from total cells and transfered onto a nitrocellulose membrane (Schleicher
and Schuell) using a 'Semi-Dry' blotting device (Bio-Rad) according to the
manufacturers manual. Bound antibody was visualized using a secondary
antibody-alkaline phosphatase conjugate according to standard protocols
(Harlow and Lane).
Generation of reporter gene fusions:
Fusions of the reporter gene firefly luciferase Uuc) to various genes in SPI2
were obtained using the suicide vectors pLB02 and pGPLOl (Gunn and
WO 00/1 4240 PCT/EP99/06514
- 39 -
Miller, 1 996), which were kindly provided by Drs. Gunn and Miller (Seattle).
For the generation of a fusion to ssaB, a 831 bp £coRV fragment of p2-2
was subcloned in £coRV digested pSK + . For the generation of a
transcriptional fusion to sseA, a 1 060 bp SmaMHincW fragment of p5-4 was
subcloned in pSK*. The inserts of the resulting constructs were recovered
as a EcoR\/Kpnl fragment and ligated with EcoH\IKpn\ digested reporter
vectors pGPL01 and pLB02. For the generation of a transcriptional fusion
to ssaJ, a 3kb Sma\IKpn\ fragment of p5-2 was directly subcloned in
pGPLOl and pLB02.
Constructs with transcriptional fusions of SPI2 genes to luc were than
integrated into the chromosome of S. typhimurium by mating between E.
coli S17-1 Apir harbouring the respective construct and a spontaneous
mutant of S. typhimurium resistant to 100 pg x ml* 1 nalidixic acid and
selection for exconjugants resistant to carbenicillin and nalidixic acid. The
targeted integration in SPI2 (for constructs using pGLPOD or the zch region
(for constructs using pLB02) was confirmed by Southernanalysis. Fusions
were then moved into a mouse-passaged strain of S. typhimurium
NCTC1 2023 by P22 transduction according to standard procedures (Maloy
etaL, 1996).
Assay of reporter genes
R-galactosidase activities of reporter gene fusions were determined
according to standard procedures (Miller, 1992).
Bacterial strains harbouring firefly luciferase fusions to SPI2 genes (strain
MvP127, sseA::/uc, strain MvP131, ssaB::luc, strain MvP266, ssaH::iuc)
were grown in medium with various Mg 2+ concentrations. The luciferase
activity of aliquots of the cultures was determined using the Promega
(Heidelberg) luciferase assay kit or custom made reagents accordingly.
WO 00/1 4240 PCT/EP99/065 1 4
- 40 -
Briefly, bacteria were pelleted by centrifugation for 5 min. at 20000 x g at
4°C and resuspended in lysis buffer (100 mM KHP0 4 , pH 7.8, 2 mM EDTA,
1 % Triton X-100, 5 mg x ml" 1 bovine serum albumin, 1 mM DTT, 5 mg x
ml" 1 lysozyme). Lysates were incubated for 15 min at room temperature
with repeated agitation and subjected to a freeze/thaw cycle. Aliquots of
the lysates (25//I) were transferred to microtiter plates (MicroFLUOR,
Dynatech) and immediately assayed after addition of 50 //I luciferase
reagent {20 mM Tricine-HCI, pH 7.8, 1.07 mM (MgC0 3 ) 4 Mg(OH) 2 , 100//M
EDTA, 33.3 mM DTT, 270 //M_Li 3 -coenzyme A, 470 //M DH-luciferin, 530
//M Mg-ATP) for photon emission using the TriLux MicroBeta luminometer
(Wallac, Turku). All assays were done in triplicates and repeated on
independent occasions.
Expression of SP/2 genes such as ssaB and ssaH is induced by low Mg 2 *
concentrations of the growth medium
S. typhimurium wild-type strain and strains harbouring luc reporter-gene
fusions to ssaB (strain MvP131) and to ssaH (strain MvP266) were grown
to mid-log phase (OD at 600 nm of about 0.5) in minimal media containing
high amounts of Mg 2+ (10 mM MgCI 2 ). This medium is referred to as
medium G. Bacteria were recovered by centrifugation, washed three times
in minimal medium containing 8 pM Mg 2 + . This medium is referred to as
medium F. Bacteria were resuspended in medium F or medium G and
growth at 37 °C was continued. Aliquots of the cultures of strains MvPI 31
and MvP266 were withdrawn at the several different time points indicated
and subjected to analysis of luciferase activity. Aliquots of the wild-type
strain were withdrawn at the same time points. Protein from total bacterial
cells was separated by SDS-PAGE and transferred to nicrocellulose
membranes. These blots were incubated with antibodies raised against
recombinant SsaP and SscA protein in order to detect proteins synthesized
after the magnesium concentration shift in the magnesium concentration.
WO 00/1 4240 PCT/EP99/0651 4
- 41 -
After shifting bacteria from a growth medium with high amounts of Mg 2 +
to a medium with limiting amounts of Mg 2+ , the expression of SPI2 genes
was highly induced. This induction can be monitored by using the reporter
gene luc fused into different positions of SPI2. Furthermore, proteins
synthesized after induction of SPI2 were detected by Western Blots.
However, even in the presence of high amounts of Mg 2+ , a low level of
expression of SPI2 genes was observed.
Expression of SP/2 genes such as sseA and ssaB Is modulated by
PhoP/PhoQ regulation
No expression of sseB or sscA was observed during growth in various rich
media, or cell culture media with or without serum. However, low amount
of SsaP were detected after growth in LB or other rich media such as brain
hart infusion (BHI). Growth in minimal medium containing less than 30 jjM
Mg 2+ induces the expression of SPI2 genes. Such effect of the Mg 2 +
concentration has so far only been observed for PhoP/PhoQ-regulated
genes. This observation is in contrast to a previous report by Valdivia and
Falkow (1 997) who postulated that SPI2 gene expression is independent of
PhoP/PhoQ. However, in a PhoP c (constitutive) strain background (CS022,
Miller et aL, 1 989) expression of SPI2 genes was not constitutive but still
dependent on the Mg 2+ concentration of the medium. This indicates that
SPI2 gene expression is modulated by PhoP/PhoQ, but that further
regulatory elements such as SsrA/B are needed.
DNA cloning and sequencing
DNA preparations and genetic manipulations were carried out according to
standard protocols (Sambrook etal, 1989). Plasmid DNA transformation of
bacterial cells was performed by electroporatton (O'Callaghan and Charbit,
1990).
WO 00/14240 PCT/EP99/06514
- 42 -
Clones harbouring fragments of SPI2 were identified from a library of
genomic DNA of S. typhimurium in A 1059 which has been described
previously (Shea et a/., 1 996). The sse and ssc genes were subcloned from
clone AS on a 5.7kb EcoR\ fragment (p5-2) and a 5.8kb HindlW fragment
(p5-4) in pBluescriptKS+ as indicated in Fig. 1 and Table 1.
DNA sequencing was performed using a primer-walking strategy. The
dideoxy method (Sanger eta/., 1977) was applied using the Pharmacia T7
sequencing system for manual sequencing and the dye terminator chemistry
for automatic analysis on a ABI377 sequencing instrument. Assembly of
contigs from DNA sequences was performed by means of AssemblyLign
and MacVector software (Oxford Molecular, Oxford). For further sequence
analyses, programs of the GCG package version 8 (Devereux eta/., 1984)
were used on the HGMP network.
Construction of non-polar mutations
The construction of non-polar mutations in sseC (MvP103), sseD (MvP1 01 )
and sseE (MvP102) are described below. All chromosomal modifications
were confirmed by PCR and Southern hybridization analysis (Southern,
1975, J. MoL Biol. 98: 503-517).
Mutant MvP1 03, sseC. A 2.6kb fragment was recovered after BamH\
and C/al digestion of p5-2 and subcloned in £te777HI/C/al-digested
pBluescript II KS + . The resulting construct termed p5-50 was
digested by HindlW, blunt ended using the Klenow fragment of DNA
polymerase and ligated to the aphT cassette. A 900 bp HincW
fragment of pSB315 containing an aminoglycoside 3'-
phosphotransferase gene (aphT) from which the transcriptional
terminator had been removed (Gal^n et a/., 1992) was ligated in the
00/14240 PCT7EP99/06514
- 43 -
same orientation into the blunted-ended Hind\\\ site of plasmid p5-50.
After transformation of E. coli XL-1 Blue and selection for resistance
against kanamycin and carbenicillin (50 A/g/ml each) one clone has
been chosen and the harbouring plasmid isolated. This plasmid was
termed p5-51 and its identity confirmed by restriction analysis. It was
further digested with Sal\ and Xba\ and the insert of 3.5kb was
ligated to Sa/l/X6al-digested pGP704. This plasmid was
electroporated intoE. coli CC1 1 8 Apir and the transformants selected
for resistance to kanamycin and carbenicillin (50 //g/ml each). As
done before, one clone was chosen, its plasmid with the according
DNA fragment in pGP704 f termed p5-53, isolated and confirmed by
restriction analysis. Plasmid p5-53 was electroporated into E, coli
SI 7-1 Apir and transferred into S. typhimurium NCTC12023
(resistant to nalidixic acid, 100 pqlvo\\ by conjugation as has been
described previously (de Lorenzo and Timmis, 1994). Exconjugants
in which the sseC gene had been replaced by the cloned gene
disrupted by insertion of the aphT cassette were selected by
resistance to kanamycin and nalidixic acid (100 //g/ml). The resulting
exconjugants were finally tested for a lactose-negative phenotype
and their sensitivity to carbenicillin. Selected clones were further
examined by Southernblot analysis. In order to exclude possible
mutations which have been acquired during the cloning procedure the
mutated sseC allele was transferred into a fresh Salmonella
background by P22 transduction (described by Maloy era/., 1996).
The resulting Salmonella strain MvP103 was examined for the
presence of the resistance cassette within the sseC gene by the use
of PCR. Amplification was performed by using the primers E25 (5'-
GAAATCCCGCAGAAATG-3') and E28 (5'-AAGGCGATAATATAAAC-
3'). The resulting fragment had a size of 1.6kb for S. typhimurium
wild-type and 2.5kb for strain MvP103.
WO 00/1 4240 PCT/EP99/0651 4
- 44 -
For complementation of non-polar mutations in sseC, the corresponding
genes were amplified by PCR from genomic DNA using a series of primers
corresponding to the region 5' of the putative start codons and to the 3'
ends of the genes. These primers introduced BamW\ restriction sites at the
termini of the amplified genes. After digestion with BamH\, the genes were
ligated to SamHI-digested pACYC184 (Chang and Cohen, 1978) and
transferred into E. cofiDHSa. The orientation of the insert was determined
by PCR, and in addition, DNA sequencing was performed to confirm the
orientation and the correct DNA sequence of the inserts. Plasmids with
inserts in the same transcriptional orientation as the Tet r gene of pACYCI 84
were selected for complementation studies and electroporated into the 5.
typhimurium strains harbouring corresponding non-polar mutations.
Mutant MvP101, sseD. A 3.0kb fragment was recovered after Pst\
and EcoRI digestion of p5-2 and subcloned in Psfl/£coRI-digested
pUC18The resulting construct termed p5-30 was digested by £coRV
and treated with alkaline phosphatase. The aphT cassette was
isolated as described above and ligated to the linearized plasmid p5-
30 in the same orientation in the unique £coRV site. After
transformation of E. coli XL-1 Blue and selection against kanamycin
and carbenicillin (50 //g/ml each) one clone has been chosen and the
harbouring plasmid isolated. This plasmid was termed p5-31 and its
identity confirmed by restriction analysis. p5-31 was further digested
with Sph\ and £coRI, a 4.0kb fragment isolated and ligated to
Sp/?l/£coRI-digested pGP704. This plasmid was electroporated into
£. coli CC118 Apir and transformants selected to kanamycin and
carbenicillin (50 //g/ml each). As done before, one clone was chosen,
its plasmid with the according DNA fragment in pGP704, termed p5-
33, isolated and confirmed by restriction analysis. Plasmid p5-33 was
electroporated into E. coli SI 7-1 Apir and transferred into S.
WO 00/1 4240 PCT/EP99/0651 4
- 45 -
typhimurium NCTC1 2023 (resistant to nalidixic acid) by conjugation
as has been described previously {de Lorenzo and Timmis, 1994).
Exconjugants in which the sseD gene had been replaced by the
cloned gene disrupted by insertion of the aphT cassette were
selected by resistance to kanamycin and nalidixic acid (100/yg/ml).
The resulting exconjugants were finally tested for a lactose-negative
phenotype and their sensitivity to carbenicillin. Selected clones were
further examined by Southernblot analysis. In order to exclude
possible mutations which might have been accumulated during the
cloning procedure the mutated sseD allele was transferred into a
fresh Salmonella background by P22 transduction (described by
Maloy et aL. 1996). The resulting Salmonella strain MvP101 was
examined for the presence of the resistance cassette within the sseD
gene by the use of PCR. Amplification was performed by using the
primers E6 (5'-AGAGATGTATTAGATAC-3') and E28 (5'-
AAGGCG ATAATATAAAC-3') . The resulting fragment had a size of
0.8kb for S, typhimurium wild-type_was used and 1.7kb in the case
of strain MvPIOI .
Mutant MvP102, deletion of parts of sseE and sscB. A 4.5kb
fragment was recovered after Sst\ and Hin6\\\ digestion of p5-2 and
subcloned in f>sfl/////7dlll-digested pKS + . The resulting construct
termed p5-40 was digested by Sma\, digested with alkaline
phospatase and ligated to the aphT cassette in the same orientation
into the unique Sma\ site created in the sseE/sseB deletion plasmid
p5-40 as described above. After transformation of E. coli XL-1 Blue
and selection against kanamycin and carbenicillin (50/yg/ml each) one
clone was chosen and the harbouring plasmid isolated. This plasmid
was termed p5-41 and its identity confirmed via restriction analysis.
It was further digested with Kpn\ and Sst\ and the insert was ligated
WO 00/1 4240 PCT/EP99/0651 4
- 46 -
to /(pnl/Ssfl-digested pNQ705. This plasmid was electroporated into
E. coll CC1 18 Apir and transformed bacteria selected to kanamycin
and chloramphenicol {50//g/ml each). As done before, one clone was
chosen, its plasmid with the according DNA fragment in pNQ705,
termed p5-43, isolated and confirmed by restriction analysis. The
resulting plasmid was used to transfer the mutated gene onto the
Salmonella chromosome as described above. Resulting clones have
been further examined by Southernblot analysis. To exclude possible
mutations which might have been acquired during the cloning
procedure the mutated sseE/sscB allele was transferred into a fresh
Salmonella background by P22 transduction (described by Maloy et
al., 1 996). The resulting Salmonella strain MvP102 was examined for
the presence of the resistance cassette within the sseE/sseB gene by
the use of PCR. Amplification was performed by using the primers E6
(5'-AGAGATGTATTAGATAC-3') and E4 {5 '-
GCAATAAGAGTATCAAC-3'). The resulting fragment had a size of
1.6kb for S. typhimurium wild-type and a size of 1.9kb for strain
MvP102.
Construction of mutant strains carrying in-frame deletions in sseC, sseD and
sscB:
Based on the observation that a non-polar in sseE did not result in a
significant attenuation of virulence in the mouse model (Hensel et aL,
1998), the generation of a deletion mutant for the sseE gene is not of
interest for the generation of carrier strains.
Construction of an in-frame deletion in sseC, mutant MvP337
WO 00/1 4240 PCT/EP99/0651 4
- 47 -
A deletion of 1 58 bp between codon 264 and 422 of sseC was generated.
Plasmid p5-2 was digested by C/al and the larger fragment containing the
vector portion was recovered and self-ligated to generate p5-60. Plasmid
p5-60 was linearized by digestion with Hind\\\, which cuts once within the
sseC gene. Primers sseC-del-1 (5'- GCT AAG CTT CGG CTC AAA TTG TTT
GGA AAA C -3') and sseE-del-2 (5'- GCT AAG CTT AGA GAT GTA TTA
GAT ACC -3') were designed to introduce HindUl sites. PCR was performed
using linearized p5-60 as template DNA. The TaqPlus polymerase
(Stratagene) was used according to the instructions of the manufacturer.
Reactions of 100 p\ volume were set up using 10 jj\ of 10 x TaqPlus
Precision buffer containing magnesium chloride, 0.8 //I of 100 mM dNTPs,
250 ng DNA template (linearized p5-8), 250 ng of each primer and 5 U of
TaqPlus DNA polymerase. PCR was carried out for 35 cycles of: 95°C for
1 minute, 60°C for 1 minute, 72°C for 6 minutes. Then a final step of
72°Cfor 10 minutes was added. 10 /yl of the PCR reaction were analyzed.
A product of the expected size was recovered, digested by HindUl, self-
ligated, and the ligation mixture was used to transform E. coli DH5a to
resistance to carbenicillin. Plasmids were isolated from transformants and
the integrity of the insert and the deletion was analyzed by restriction
digestion and DNA sequencing. The insert of a confirmed construct was
isolated after digestion with Xba\ and Kpn\ and ligated to XbaMKpnV
digested vector pKAS32. The resulting construct was used to transform E.
coli SI 7-1 yipir to resistance to carbenicillin, and conjugational transfer of
the plasmid to S. typhimurium (Nal R , Strep") was performed according to
standard procedures (de Lorenzo and Timmis, 1 994) . Exconjugants that had
integrated the suicide plasmid by homologous recombination were selected
by resistance to nalidixic acid and carbenicillin, and screened for sensitivity
to streptomycin. Such clones were grown in LB to OD600 of about 0.5 and
aliquots were plated on LB containing 250 /yg/ml streptomycin to select for
colonies which had lost the integrated plasmid and undergone allelic
WO 00/14240 PCT/EP99/0651 4
- 48 -
exchange. Clones resistant to streptomycin but sensitive to carbenicillin
were used for further analysis. Screening of mutants with a deletion within
the sseC locus was performed by PCR using primers sseC-For (5'- ATT GGA
TCC GCA AGC GTC CAG AA -3') and sseC-Rev (5- TAT GGA TCC TCA
GAT TAA GCG CG-3 r ). Amplification of DNA from clones containing the
wild-type sseC allele resulted in a PCR product of 1 520 bp, use of DNA
from clones harbouring a sseC allele with an internal deletion resulted in a
PCR product of 1050 bp. The integrity of clones harbouring the sseC
deletion was further confirmed by Southern analysis of the sseC locus.
Finally, the sseC locus containing the internal in-frame deletion was moved
into a fresh strain background of S. typhimurium by P22 transduction
(Maloy etaL, 1996) and the resulting strain was designated MvP 337.
Construction of an in-frame deletion in sseD, mutant strain MvP338
A deletion of 1 16 bp between codon 26 and 142 of sseD was generated.
Plasmid p5-2 was digested by Hinti\\\IPst\ and a fragment of 2.1kb was
isolated and subcloned in A///?dlll/Psfl-digested vector pBluescript SK + . The
resulting construct was designated p5-8. p5-8 was linearized by digestion
with £coRV, which cuts twice within the sseD gene. Primers sseD-del-1 (5'-
ATA GAA TTC GGA GGG AGA TGG AGT GGA AG -3') and sseD-del-2 (5'-
ATA GAA TTC GAA GAT AAA GCG ATT GCC GAC -3') were designed to
introduce EcoRI sites. PCR was performed using linearized p5-8 as template
DNA. The TaqPlus polymerase (Stratagene) was used according to the
instructions of the manufacturer. Reactions of 100 /j\ volume were set up
using 1 0 jj\ of 1 0 x TaqPlus Precision buffer containing magnesium chloride,
0.8 jj\ of 100 mM dNTPs, 250 ng DNA template (linearized p5-8), 250 ng
of each primer and 5 U of TaqPlus DNA polymerase. PCR was carried out
for 35 cycles of: 95°C for 1 minute, 60°C for 1 minute, 72°C for 5
minutes. Then a final step of 72 °C for 1 0 minutes was added. 1 0 //I of the
WO 00/1 4240 PCT/EP99/0651 4
- 49 -
PCR reaction were analyzed. A product of the expected size was recovered,
digested by EcoRI, self-ligated, and the ligation mixture was used to
transform £. co//DH5crto resistance to carbenicillin. Ptasmids were isolated
from transformants and the integrity of the insert and the deletion was
analyzed by restriction mapping and DNA sequencing. The insert of a
confirmed construct was isolated after digestion with Xba\ and Kpn\ and
ligated to X6al/Kpnl-digested vector pKAS32. The resulting construct was
used to transform E. coli SI 7-1 Apir to resistance to carbenicillin, and
conjugational transfer of the plasmid to S. typh /murium (Nal R f Strep R ) was
performed according to standard procedures (de Lorenzo and Timmis,
1 994) . Exconjugants that had integrated the suicide plasmid by homologous
recombination were selected by resistance to nalidixic acid and carbenicillin,
and screened for sensitivity to streptomycin. Such clones were grown in LB
to OD600 of about 0.5 and aliquots were plated on LB containing 250
/yg/ml streptomycin to select for colonies which had lost the integrated
plasmid and undergone allelic exchange. Clones resistant to streptomycin
but sensitive to carbenicillin were used for further analysis. Screening of
mutants with a deletion within the sseD locus was performed by PCR using
primers sseD-For (5'- GAA GGA TCC ACT CCA TCT CCC TC -3') and sseD-
Rev (5- GAA GGA TCC ATT TGC TCT ATT TCT TGC-3'). Amplification of
DNA from clones containing the wild-type sseD allele resulted in a PCR
product of 560 bp, use of DNA from clones harbouring a sseD allele with
an internal deletion resulted in a PCR product of 220 bp. The integrity of
clones harbouring the sseD deletion was further confirmed by
Southernanalysis of the sseD locus. Finally, the sseD locus containing the
internal in-frame deletion was moved into a fresh strain background of S.
typhimurium by P22 transduction (Maloy et aL, 1996) and the resulting
strain was designated MvP338.
Construction of an in-frame. deletion in ssctf, mutant strain MvP339
WO 00/14240
- 50 -
PCT/EP99/06514
A deletion of 128 bp between codon 32 and 160 of sscB was generated.
A 3kb Bgl\\ fragment of plasmid p5-2 was ligated into the BamYW site of
pBluescript KS+ to generate plasmid p5-70. Plasmid p5-70 was linearized
by digestion with Nco\, which cuts once within the sscB gene. Primers
sscfl-dei-1 (5'- ATG GGA TCC GAG ATT CGC CAG AAT GCG CAA -3') and
sscff-del-2 (5'- ATG GGA TCC ACT GGC ATA AAC GGT TTC CGG -3')
were designed to introduce BamH\ sites. PCR was performed using
linearized p5-70 as template DNA. The TaqPlus polymerase (Stratagene)
was used according to the instructions of the manufacturer. Reactions of
100 jj\ volume were set up using 10 //I of 10 x TaqPlus Precision buffer
containing magnesium chloride, 0.8 //I of 100 mM dNTPs, 250 ng DNA
template (linearized p5-70), 250 ng of each primer and 5 U of TaqPlus DNA
polymerase. PCR was carried out for 35 cycles of: 95 °C for 1 minute,
60°C for 1 minute, 72°C for 6 minutes. Then a final step of 72°C for 10
minutes was added. 10 //I of the PCR reaction were analyzed. A product of
the expected size was recovered, digested by BamH\, self-ligated, and the
ligation mixture was used to transform E. co/i DH5ar to resistance to
carbenicillin. Plasmids were isolated fromtransformants and the integrity of
the insert and the deletion was analyzed by restriction analysis and DNA
sequencing. The insert of a confirmed construct was isolated after digestion
with Xbal and Kpn\ and ligated to X6al//<pnl-digested vector pKAS32. The
resulting construct was used to transform E. co/i S17-1 Apir to resistance
to carbenicillin, and conjugational transfer of the plasmid to S. typhimurium
(Nal R , Strep R ) was performed according to standard procedures (de Lorenzo
and Timmis, 1994). Exconjugants that had integrated the suicide plasmid
by homologous recombination were selected by resistance to nalidixic acid
and carbenicillin, and screened for sensitivity to streptomycin. Such clones
were grown in LB to OD600 of about 0.5 and aliquots were plated on LB
containing 250 //g/ml streptomycin to select for colonies which had lost the
WO 00/1 4240 PCT/EP99/0651 4
- 51 -
integrated plasmid and undergone allelic exchange. Clones resistant to
streptomycin but sensitive to carbenicillin were used for further analysis.
Screening of mutants with a deletion within the sseC locus was performed
by PCR using primers sscB-For {5'- ATT GGA TCC TGA CGT AAA TCA TTA
TCA -3') and sscB-Rev (5- ATT GGA TCC TTA AGC AAT AAG TGA ATC -
3'). Amplification of DNA from clones containing the wild-type sscB allele
resulted in a PCR product of 480 bp, use of DNA from clones harbouring a
sscB allele with an internal deletion resulted in a PCR product of 100 bp.
The integrity of clones harbouring the sseC deletion was further confirmed
by Southernanalysis of the sscB locus. Finally, the sscB locus containing the
internal in-frame deletion was moved into a fresh strain background of S.
typhimurium by P22 transduction (Maloy et aL, 1996) and the resulting
strain was designated MvP339.
Construction of a deletion mutation in the sseC gene
In a further approach the complete sequence of the chromosomal sseC gene
was deleted by allelic replacement with a deleted copy of the gene. The
deletion was constructed in a suicide plasmid (pCVD442 (Donnenberg et
at., 1991). First, two DNA fragments flanking the sseC gene (fragment A,
carrying artificial Sa//and Xbal sites at its 5' and 3' ends, respectively; and
fragment B, carrying artificial Xbal and Sac/ sites at its 5' and 3' ends,
respectively) were amplified by PCR. The oligonucleotides used for PCR
were: 1.) sseDelfor! GCTGTCGACTTGTAGTGAGTGAGCAAG (3' nucleotide
corresponds to bp 941 in included sequence: Fig 21 A); 2.) sseCDelrev2
GGATCTAGATTTTAGCTCCTGTCAGAAAG (3' nucleotide corresponds to
bp 2585 in included sequence, oligo binds to reverse strand); 3.)
sseCDelfor2 GGATCTAGATCTGAGGATAAAAATATGG {3' nucleotide
corresponds to bp 4078 in included sequence); 4.) sseDelrevI
GCTGAGCTCTGCCGCTGACGGAATATG (3' nucleotide corresponds to bp
WO 00/1 4240 PCT/EP99/065 1 4
- 52 -
5592 in included sequence, oligo binds to reverse strand). The resulting
PCR fragments were fused together via the Xbal site. The resulting
fragment was cut with Sail and Sad and cloned into pCVD442 cut with Sail
and Sacl. The resulting plasmid was introduced into S.typhimurium
NCTC1 2023 by conjugation and chromosomal integrants of the plasmid into
the sseC locus were selected for by the plasmid-encoded ampicillin
resistance marker. In a second step, clones which had lost the plasmid were
screened for by loss of ampicillin resistance. The resulting clones were
tested for chromosomal deletion of the sseC gene by PCR, and deletion of
a 1455 bp fragment, comprising the entire sseC open reading frame, was
confirmed. This AsseC mutant strain was named IIi-57AsseC.
Construction of a sseC-aroA double mutant
In order to construct a double mutant which can serve as a prototype for
a live attenuated vaccine, the sseC:aph T (Km r ) marker from MvP103 was
transferred by P22 phage transduction into S.typhimurium SL7207 (hisGAQ
DEL407 [aroA 544:Tn1 0], Tc R ) a strain carrying a stable deletion in the aroA
gene.
Example 3: Invasion and intracellular growth in tissue culture
Intramacrophage replication of mutant strains
Several strains which are defective in their ability to replicate inside
macrophages and macrophage-like cell lines have been tested, as
macrophage survival and replication are thought to represent an important
aspect of Salmonella pathogenesis in vivo (Fields et aL, 1 986). It has been
reported previously that a number of SPI2 mutant strains were not defective
for survival or replication within RAW macrophages (Hensel et aL, 1 997b)
WO 00/14240 PCT/EP99/06514
- 53 -
but subsequent experiments have revealed that some SPI2 mutants can be
shown to have a replication defect if aerated stationary phase bacterial
cultures opsonized with normal mouse serum are used (see also
accompanying paper: Cirillo eta/., 1998). The increase in cfu for different
strains in RAW macrophages over a 16 h period is shown in Fig. 3.
Replication defects were observed for strains carrying mutations in ssaV
(encoding a component of the secretion apparatus), sseB and sseC and to
a lesser extent for strains carrying mutations in sseE. Partial
complementation of this defect was achieved with strains harbouring
plasmids carrying functional copies of sseB and sseC, HH103 and
MvP1 03[psseC], respectively. The ability of SPI2 mutant strains to replicate
inside the J774.1 macrophage cell line (Fig. 4A) and in periodate-elicited
peritoneal macrophages from C3H/HeN mice (Fig. 4B) has also been tested.
Similar replication defects of S. typhimurium carrying transposon or non-
polar mutations in SPI2 genes were observed, regardless of the phagocyte
cell-type examined, although the peritoneal elicited cells had superior
antimicrobial activity compared to either cell line.
Macrophage survival assays
RAW 264.7 cells (ECACC 91062702), a murine macrophage-like cell line,
were grown in Dulbecco's modified Eagle's medium (DMEM) containing
10% teeter calf serum (FCS) and 2 mM glutamine at 37°C in 5% C0 2 . S.
typhimurium strains were grown in LB to stationary phase and diluted to
ar » OD eoo of 0.1 and opsonized for 20 min in DMEM containing 10% normal
mouse serum. Bacteria were then centrifuged onto macrophages seeded in
24 well tissue culture plates at a multiplicity of infection of approximately
1:10 and incubated for 30 min. Following infection, the macrophages were
washed twice with PBS to remove extracellular bacteria and incubated for
WO 00/1 4240 PCT7EP99/0651 4
- 54 -
90 min (2h post-infection) or 16 h in medium containing gentamicin (12
/vg/ml). Infected macrophages were washed twice with PBS and lysed with
1% Triton X-100 for 10 min and appropriate aliquots and dilutions were
plated onto LB agar to enumerate cfu.
Survival of opsonized S. typhimurium strains in J774.1 cells (Ralph et aL,
1 975) or C3H/HeN murine peritoneal exudate cells (from Charles River
Laboratories, Wilmington, MA) was determined essentially as described by
DeGroote et aL (1997), but without the addition of interferon-^- Briefly,
peritoneal cells harvested in PBS with heat-inactivated 10% foeta , calf serum
4 days after intraperitoneal injection of 5 mM sodium periodate (Sigma, St.
Louis, MO) were plated in 96-well flat-bottomed microtiter plates (Becton-
Dickinson, Franklin Lakes, NJ) and allowed to adhere for 2 h. Non-adherent
cells were flushed out with prewarmed medium containing 10% heat-
inactivated foeta! calf serum. In previous studies, we have established that
>95% of the cells remaining after this procedure are macrophages. S.
typhimurium from aerated overnight cultures was opsonized with normal
mouse serum and centrifuged onto adherent cells at an effector to target
ratio of 1:10. The bacteria were allowed to internalize for 15 min, and
washed with medium containing 6 //g/ml gentamicin to kill extracellular
bacteria. At 0 h and 20 h, cells were lysed with PBS containing 0.5%
deoxycholate (Sigma, St. Louis, MO), with plating of serial dilutions to
enumerate colony-forming units.
Example 4 : Evaluation of safety in the S. typhimurium mouse model of
salmonellosis
Virulence tests with strains carrying non-polar mutations
WO 00/1 4240 PCT7EP99/0651 4
- 55 -
DNA sequence analysis suggested that the sse genes might encode effector
proteins of the secretion system, but apart from a possible polar effect from
a transposon insertion in sscA no strains carrying mutations in these genes
were recovered in the original STM screen for S. typhimurium virulence
genes using mTn5 mutagenesis (Hensel et aL, 1995), and their role in
virulence was unclear. To address this question, strains carrying non-polar
mutations in sseC, sseD and sseEsscB (Fig. 1) have been constructed and
subjected to virulence tests. Table 4 shows that all mice inoculated with
strains carrying mutations sseC and sseD survived a dose of 1 x 10 4 cfu,
three orders of magnitude greater than the LD 50 of the wild-type strain,
which is less than 10 cfu when the inoculum is administered by the i.p.
route (Buchmeier et aL, 1993; Shea et af, 1996). The same strains
containing a plasmid carrying the corresponding wild-type allele were also
inoculated into mice at a dose of 1 x 10 4 cfu. No mice survived these
infections, which shows that each mutation can be complemented by the
presence of a functional copy of each gene, and that each of these genes
plays an important role in Salmonella virulence. Strains carrying non-polar
mutations in sseEsscB caused lethal infections when approximately 1 x 10 4
cells of each strain were inoculated into mice by the i.p. route {Table 4) and
were analyzed in more detail by a competition assay with the wild-type
strain in mixed infections (five mice/test) to determine if they were
attenuated in virulence. The competitive index, defined as the output ratio
of mutant to wild-type bacteria, divided by the input ratio of mutant to wild-
type bacteria, shows that the sseEsscB mutant was not significantly
different to that of a fully virulent strain carrying an antibiotic resistance
marker, which implies that this gene does not play a significant role in
systemic Salmonella infection of the mouse.
Table 4. Virulence of S. typhimurium strains in mice.
WO 00/14240
- 56 -
PCT/EP99/06514
Strain Genotype
Mouse survival Mouse survival after
Competitive
after inoculation 3 inoculation 3 with mutant index in vivo
with bacterial strain + complementing
plasmid
NCTC120 wild-type
23
0/5
MvPlOl AsseD::apfiT 5/5
MvP102 AsseEsscB::aphT 4/4
MvP103 sseCv.aphT 5/5
n.d.
n.d.
n.d.
0/5
0.98
>0.01
0.79
>0.01 (oral)
>0.01 (i.p.)
4
B Mice were inoculated intraperitoneally with 1x10 cells of each strain
to b Result of competition between wild-type strain NCTC 12023 and a virulent mTnJ
mutant identified in the STM screen.
15
Example 5 : Vaccination with the sseC::aphT, and AsseD::aph T mutant S.
typhimurium strains MvP103 and MvPIOI
20 Strains carrying non-polar mutations as live vaccine carriers
To confirm the suitability of the MvP101 and MvP103 mutants as live
vaccine carriers their level of attenuation was evaluated by determining the
LD BO after oral inoculation in mice. Groups of 10 mice were fed with serial
25 dilutions of either MvP101, MvP103 or the wild-type parental strain
NCTCNCTC1 2023 and dead animals were recorded within a period of 10
WO 00/1 4240 PCT/EP99/0651 4
- 57 -
days postinfection. The obtained results demonstrated that both mutants
are highly attenuated when given orally to BALB/c mice (LD 50 above 10 9 )
when compared with the parental strain (LD 50 = 6.9 x 10 5 CFU).
After intraperitoneal inoculuation the LD 50 of S. typhimurium NCTC12023
wild-type in BALB/c is 6 bacteria, and the LD 50 of MvP103 in BALB/c is
2.77 x 10 6 after intraperitoneal inoculation. The mutation can be
complemented by psseC, but no LD 50 determination for the complemented
mutant strain was performed. LD 5Q of MvP1 01 in BALB/c is 3.54 x 1 0 6 after
intraperitoneal inoculation. A partial complementation by plasmid p5-K 1 was
possible. An intraperitoneal LD 50 for MvP101 [p5-K1] of 8.45 x 10 2 was
determined. (Description of p5-K1 : a 3.2kb Pstl fragment of p5-2 containing
sseC'sseDsseEsscBsseF' was subcloned in low copy number cloning vector
pWSK29).
Determination of the LD 50
Doses ranging from 10 5 to 10 9 CFU of either S. typhimurium
NCTCNCTC 12023 (wild-type) or the mutants MvP103 and MvP101 were
orally inoculated into groups of 10 mice and survival was recorded over 10
days.
LD 50 of S typhimurium wild-type and mutant strains MvP101 and MvP103
after intraperitoneal infection was determined by inoculation of doses
ranging from 10 1 to 10 7 CFU into groups of 5 female BALB/c mice of 6-8
weeks of age. Survival was recorded over a period of three weeks. The LD 50
dose of the challenge strains was calculated by the method of Reed and
Muench (Reed and Muench, 1938).
Immunization protocols
WO 00/14240 PCT/EP99/06514
- 58 -
For vaccination, bacteria were grown overnight until they reach medium log
phase. Then, they were harvested by centrifugation (3,000 x g) and
resuspended in 5% sodium bicarbonate. Mice were immunized four times
at 15 day intervals by gently feeding them with the bacterial suspension
(10 9 CFU/mouse) in a volume of approximately 30 //L Control mice were
vaccinated with the carrier, lacking piasmid.
Cytotoxicity assay
Spleen cells were obtained from mice 14 days after the last immunization
and 2x10 6 effector cells were restimulated in vitro for 5 days in complete
medium supplemented with 20 U/ml of rlL-2 and 20 jjM of the ISGP1
peptide (fc-gal p876-884, TPHPARIGL), which encompasses the
immunodominant H-2L d -restricted fc-gal epitope. After restimulation, the
assay was performed using the [ 3 H]-thymidine incorporation method. In
brief, 2x10 6 of P815 cells per ml were labelled with [ 3 H]-thymidine for 4 h
in either complete medium or complete medium supplemented with 20 jjM
of &GP1 peptide and used as target cells. Following washing, 2x1 0 5 labelled
targets were incubated with serial dilutions of effector cells in 200 jj\ of
complete medium for 4 h at 37°C. Cells were harvested and specific lysis
was determined as follows: [(retained c.p.m. in the absence of effectors) -
(experimentally retained c.p.m. in the presence of effectors) /retained c.p.m.
in the absence of effectors] x 100.
Example 6 : Evaluation of the induced immune response
Induction of mucosal immune responses after oral vaccination
To achieve protection against mucosal pathogens using live Salmonella
carriers, elicitation of an efficient mucosal response is highly desirable.
WO 00/14240 PCT7EP99/06514
- 59 -
Therefore, the presence of (S-gal-specific antibodies in intestinal washes
from mice immunized with either MvP101, MvP103 or SL7207 carrying
pAH97 was investigated 52 days after immunization. As shown in Fig. 5.,
immunization with all three carriers stimulate the production of significant
amounts of /?-gal-specific IgA and, to a lesser extent, favor the transudation
of antigen-specific IgG in the intestinal lumen. No statistically significant
differences were observed among the mucosal responses to the different
recombinant clones.
Cellular immune responses triggered after oral immunization with sseC and
sseD mutants expressing fi-ga/
To evaluate the efficacy of the antigen-specific T cell responses generated
in immunized mice, spleen cells were enriched in CD4+ T cells and
restimulated in vitro during four days with R-gal. As shown in Fig. 6,
although antigen-specific CD4 + -enriched spleen cells were generated after
vaccination with the three carriers, MvP1 03 and MvP1 01 were significantly
more efficient than SL7207 (P 0.05) at triggering specific cellular immune
response. In contrast, cells isolated from mice immunized with the carrier
alone failed to proliferate in the presence of R-gal.
To investigate the Th-type of immune response triggered by immunization,
the content of IFN-y, IL-2, IL-4, IL-5, IL-6 and IL-10 was measured in the
supernatant fluids of restimulated cells. The results demonstrated that a
predominant Th1 response pattern was induced in mice immunized with all
the carriers. IFN-k was the only cytokine with significantly increased levels
in comparison to those observed in supernatants from spleen cells isolated
from mice immunized with plasmidless carriers (Fig. 7). Interestingly, in
agreement with the IgG isotype patterns, the levels of IFN-y detected in
WO 00/1 4240 PCT/EP99/065 1 4
- 60 -
supernatants from cells of mice immunized with MvP103 [pAH97] were
significantly higher (P 0.05} than those from animals receiving either
MvP101 [pAH97] or SL7207 [pAH97J (Fig. 7).
Antigen-specific antibody responses generated in mice orally immunized
with the attenuated S. typhimurium vaccine carriers expressing the model
antigen R-gal
Groups of mice were immunized with the recombinant strains MvP101
[pAH97] and MvP103 [pAH97]. To estimate the efficacy of the prototypes
another group was vaccinated with the well-established carrier strain
SL7207 [pAH97]. The abilities of the different carriers to induce a systemic
humoral response was determined by measuring the titer of B-gal-specific
antibodies in the serum of vaccinated mice. As shown in Fig. 8, significant
titers of B-gal-specific IgG and IgM antibodies were detected at day 30 in
all vaccinated animals. In contrast to the IgM titers which reach a plateau
at day 30, the titers of IgG steadily increased until day 52 from
immunization when the experiment was concluded. Although all tested
carriers exhibit an excellent performance, the MvP1 03 mutant was the most
efficient at inducing anti-B-gal IgG antibodies (P 0.05). No significant levels
of B-gal-specif ic IgA were detected in mice immunized with any of the three
recombinant clones (data not shown).
To determine the subclass distribution of the anti-B-gal IgG, serum samples
were analyzed for specific levels of lgG1, lgG2a, lgG2b and lgG3. The
results shown in Fig. 9 demonstrate that the main fi-gal-specific IgG isotype
present in sera of all immunized mice was lgG2, suggesting of a
predominant Th1 response. Interestingly, a lower concentration of lgG1 (P
0.05) was observed in mice immunized with MvP103 than in those
WO 00/1 4240 PCT/EP99/0651 4
- 61 -
receiving MvP101 and SL7202, indicating a similar response pattern in
animals immunized with the last two carriers.
Sample collection
Serum samples were collected at different time points and monitored for the
presence of B-gal-specific antibodies. At day 52 after immunization,
intestinal lavages were obtained by flushing the small intestine with 2 ml of
PBS supplemented with 50 mM EDTA, 0. 1 % bovine serum albumin and 0. 1
mg/ml of soybean trypsin inhibitor (Sigma). Then, the lavages were
centrifuged (10 min at 600 x g) to remove debris, supernatants were
removed and supplemented with phenylmethylsulfonyl fluoride (10 mM)
and NaN 3 , and stored at -20°C.
Antibody assays
Antibody titres were determined by an enzyme-linked immunosorbent assay
(ELISA). Briefly, 96 well Nunc-lmmuno MaxiSorp™ assay plates (Nunc,
Roskilde, Denmark) were coated with 50 /yl/well R-gal (5 //g/ml) in coating
buffer (0.1 M Na 2 HP0 4 , pH 9.0). After overnight incubation at 4°C, plates
were blocked with 10% FCS in PBS for 1 h at 37 °C. Serial two-fold
dilutions of serum in FCS-PBS were added (100 /yl/well) and plates were
incubated for 2 h at 37°C. After four washes with PBS-0.05% Tween 20,
secondary antibodies were added: biotinylated ychain specific goat anti-
mouse IgG, /i-chain specific goat anti-mouse IgM, a-chain specific goat anti-
mouse IgA antibodies (Sigma, St. Louis, M0) or, to determine IgG subclass,
biotin-conjugated rat anti-mouse IgGI, lgG2a, lgG2band lgG3 (Pharmingen)
and plates were further incubated for 2 h at 37°C. After four washes, 100
WO 00/14240 PCT/EP99/06514
- 62 -
jj\ of peroxidase-conjugated streptavidin (Pharmingen, St. Diego, CA) were
added to each well and plates were incubated at room temperature for 1 h.
After four washes, reactions were developed using ABTS [2,2'-azino-bis-(3-
ethybenzthiazoline-6-sulfonic acid)] in 0.1 M citrate-phosphate buffer (pH
4.35) containing 0.01% H 2 0 2 . Endpoint titers were expressed as the
reciprocal log 2 of the last dilution which gave an optical density at 405 nm
0.1 unit above the values of the negative controls after a 30 min
incubation.
To determine the concentration of total Ig present in the intestinal lavages,
serial dilutions of the corresponding samples were incubated in microtiter
plates that had been coated with goat anti-mouse IgG, IgM and IgA as
capture antibodies (100 //g/well, Sigma) and serial dilutions of purified
mouse IgG, IgM and IgA (Sigma) were used to generate standard curves.
Detection of antigen-specific Ig was performed as described above.
Induction of antigen-specific CTL responses in mice orally immunized with
the carrier strains expressing R-gal
The elicitation of MHC class I restricted responses are particularly important
for protection against many intracellular pathogens and tumors. It has been
shown that antigen-specific CD8+ CTL can be generated both in vitro and
in vivo after immunization with recombinant Salmonella spp. expressing
heterologous antigens. Therefore, we considered it important to determine
whether the tested carriers were also able to trigger a yf?-gal-speciftc CTL
response. Spleen cells were collected from mice vaccinated with either
MvP101 [pAH97], MvP103 [pAH97) or SL7207 [pAH97] at day 52 from
immunization and restimulated in vitro with /?GP1 -pulsed syngenic spleen
cells for 5 days. As shown in Fig. 10, the spleen cells from mice immunized
WO 00/1 4240 PCT/EP99/0651 4
- 63 -
with either of the three constructs induced significant lysis of /?GP1 -loaded
target cells compared with unloaded controls. The more efficient responses
were observed using the carrier strain MvP103. The lysis was mediated by
CD8+ T cells since the cytotoxic activity was completely abrogated when
CD8+ T effector cells were depleted (data not shown).
Cytokine determination
Culture supernatants were collected from proliferating cells on days 2 and
4, and stored at -70°C. The determination of IL-2, IL-4, IL-5, IL-6, IL-10
and IFN-k was performed by specific ELISA. In brief, 96-well microtiter
plates were coated overnight at 4°C with purified rat anti-mouse IL-2 mAb
(clone JESG-1A12), anti-IL-4 mAb (clone 11B11), anti-IL-5 mAb (clone
TRFK5), anti-IL-6 mAb (clone MP5-20F3), anti-IL-1 0 mAb (clone JES5-2A5),
and antMFN-K mAb (clone R4-6A2) (Pharmingen). After three washes,
plates were blocked and two-fold dilutions of supernatant fluids were
added. A standard curve was generated for each cytokine using
recombinant murine IL-2 (rlL-2), rlL-4, rlL-5, rlL-6, rlFN-y, and rlL-10
(Pharmingen). Plates were further incubated at 4°C overnight. After
washing, 100/yl/well of biotinylated rat anti-mouse IL-2 (clone JES6-5H4),
IL-4 (clone BVD6-24G2), IL-5 (clone TRFK4), IL-6 (clone MP5-32C1 1 ), IL-10
(clone SXC-1 ) and INF-p (clone XMG1 .2) monoclonal antibodies were added
and incubated for 45 min at RT. After six washes, streptavidin-peroxidase
conjugated was added and incubated for 30 min at RT. Finally, the plates
were developed using ABTS.
Depletion of CD8 + spleen cells.
WO 00/1 4240 PCT/EP99/0651 4
- 64-
The CD8 + cell subset was depleted using MiniMACS Magnetic Ly-2
Microbeads according to the manufacturer's instructions (Miltenyi Biotec).
Depleted cell preparations contained 1 % CD8+ cells.
FACScan analysis
Approximately 5x1 0 5 cells were incubated in staining buffer (PBS
supplemented with 2% FCS and 0.1% sodium azide) with the desired
antibody or combination of antibodies for 30 min at 4°C. After washes,
cells were analysed on a FACScan (Becton Dickinson). The monoclonal
antibodies used were FITC-conjugated anti-CD4 and anti-CD8 (clones
H129.19 and 53-6.7; Pharmingen).
Example 7 : Cell proliferation
Cell proliferation assay
Spleen cell suspensions were enriched for CD4 + T cells using MiniMACS
Magnetic Ly-2 and indirect goat-anti-mouse-IgG Microbeads according to
the instructions of the manufacturer (Mitenyi Biotec GmbH, Germany). Cell
preparations contained > 65% of CD4+ cells. Cells were adjusted to
2x1 0 6 cells/ml in complete medium supplemented with 20 U/ml of mouse
rlL-2 (Pharmigen), seeded at 1 00//l/well in a flat-bottomed 96-well microliter
plate (Nunc, Roskilde, Denmark) and incubated for four days in the presence
of different concentrations of soluble fc-gal. During the final 18 hours of
culture 1 /yCi of l 3 H]-thymidine (Amersham International, Amersham, U.K.)
was added per well. The cells were harvested on paper filters using a cell
harvester and the ( 3 H]-thymidine incorporated into the DNA of proliferating
cells was determined in a ^scintillation counter.
WO 00/14240
- 65 -
PCT/EP99/06514
Example 8 : Characterization of ssr genes and construction and
characterization of the ssr mutant 5. typhimurium strains MvP284 ,
MvP320 and MvP333
Homology of the two component regulator genes ssrA and ssrB of SP/2
with other bacteria/ proteins
The SPI2 gene ssrA encodes a protein similar to sensor components of
bacterial two component regulatory systems as has been described before
(Ochman ef al. t 1996). For consistency with the nomenclature of SPI2
virulence genes (Hensel et al. f 1997b; Valdivia and Falkow, 1997), this
gene is designated ssrA. Downstream of ssrA f an ORF with coding capacity
for a 24.3 kDa protein was identified. This gene shares significant similarity
with a family of genes encoding transcriptional activators like DegU of
Bacillus subtilis r UvrY of E. co/i and BvgA of Bordetella pertussis. Therefore,
it is likely that the protein acts as the regulatory component of the ssr
system and the gene was designated ssrB.
Inverse regulation of SPI1 and SPI2
The expression of the type III secretions systems of SPI1 and SPI2 is tightly
regulated by environmental conditions. While SPI1 is induced during late
log/early stationary phase after growth in rich media of high osmolarity and
limiting 0 2 (oxygen) concentration, no induction of SPI2 gene expression
was observed. In contrast, after growth in minimal medium with limiting
amounts of Mg 2+ (8 pM) the ssaB::/uc fusion was highly expressed while
the sipC::/acZ fusion was not expressed. The expression of the ssaBwIuc
fusion is dependent on the function of SsrA/B, since there is no expression
in the ssrfl-negaiive background strain P8G12 (Hensel et a/., 1998). The
expression of the sipC.JacZ fusion is dependent on HilA, the transcriptional
WO 00/1 4240 PCT/EP99/0651 4
- 66 -
regulator of SPI1. We also observed that a mutation in ssrB affects
expression of the sipC::lacZ fusion. This indicates that SPI2 has a regulatory
effect on the expression of SPI1 genes.
Bacterial strains harbouring a luc fusion to ssaBin SPI2 (strain MvP131) and
a lacZ fusion to sipC in SPI1 (strain MvP239) were grown under conditions
previously shown to induce SPI gene expression. Bacteria were grown over
night in minimal medium containing 8 phA Mg 2 + or over night in LB broth
containing 1 % NaCI (LB 1%NaCI). The Luc activity of strain MvP131 and
B-galactosidase activity of strain MvP239 were determined. As a control,
both reporter fusions were assayed in the ssrB negative strain background
of P8G12.
Expression levels of lacZ reporter-gene fusions to SPI genes were assayed
as described by Miller, 1992.
Construction and analysis of sseA reporter gene fusion
A 1.1 kb SmaMHincW fragment of p5-4 was subcloned into pGPLOl, a
suicide vector for the generation of luc fusions (Gunn and Miller, 1 996). The
resulting construct, in which 1.0kb upstream and 112 bp of sseA is
transcriptionally fused to luc was used to transform E. coli S17-1 Apir, and
conjugational transfer to S. typhimurium performed as described previously
(Gunn and Miller, 1996). Strains that had integrated the reporter gene
fusion into the chromosome by homologous recombination were confirmed
by PCR and Southern hybridization analysis. Subsequently, the fusion was
moved by P22 transduction into the wild-type and various mutant strain
backgrounds with mTn5 insertions in SPI1 or SPI2 genes (Maloy et aL,
1996). As a control, a strain was constructed harbouring a chromosomal
integration of pLB02, a suicide plasmid without a promoter fusion to the luc
gene (Gunn and Miller, 1996). For the analysis of gene expression, strains
WO 00/1 4240 PCT/EP99/0651 4
- 67 -
were grown for 16 h in minimal medium with aeration. Aliquots of the
bacterial cultures were lysed and luciferase activity was determined using
a luciferase assay kit according to the manufacturer's protocol (Boehringer
Mannheim). Photon detection was performed on a Microplate
scintillation/luminescence counter (Wallac, Turku). All assay were done in
triplicate, and replicated on independent occasions.
Expression of sseA is dependent on SsrAB
To establish if the sse genes are part of the SPI2 secretion system, the
expression of an sseA::/uc reporter gene fusion, integrated by homologous
recombination into the chromosome of different SPI2 mutant strains, has
been investigated (Fig. 1 1). Transcriptional activity of sseA in a wild-type
background during growth in minimal medium was dramatically reduced by
inactivation of the SPI2 two-component system. Transposon insertions in
ssrA (mutant strain P3F4) and ssrB (mutant strain P8G12), encoding the
sensor component and the transcriptional activator, respectively, resulted
in 250 to 300-fold reduced expression of sseA. Inactivation of hi/A, the
transcriptional activator of SPI1 (Bajaj et aL, 1996), had no effect on sseA
gene expression. Transposon insertions in two genes encoding components
of the SPI2 type III secretion apparatus (ssaJ:\xr\lx\5 and ssaT::mTr\5;
mutant strains P1 1D10and P9B7; Shea era/., 1 996) also had no significant
effect on the expression of sseA. These data show that SsrA/B is required
for the expression of sseA, but that hi/A is not.
Expression of SPI2 genes within macrophages is dependent on SsrA/B
The presence of S. typhimurium within eukaryotic cells (macrophages)
induces the expression of SPI2 genes as indicated by analysis of fusions to
WO 00/14240 PCT/EP99/06514
- 68 -
ssaB and ssaH. This expression is dependent on the two component
regulatory system SsrA/B encoded by SPI2.
The murine macrophage-line cell line J744 was used for this experiment.
Macrophages were infected at a multiplicity of infection of 10 bacteria per
macrophage with MvP1 31 (luc fusion to ssaB), MvP266 (fuc fusion of ssaH)
and MvP244 (fuc fusion to ssaB in a ssrB negative background).
Extracellular bacteria were killed by the addition of gentamicin (20 pg/ml).
At various time points, macrophages were lysed by the addition of 0.1%
Triton X-100, and intracellular bacteria were enumerated by plating serial
dilutions onto LB agar plates. A further aliquot of the bacteria was
recovered and the lucif erase activity was determined. Lucif erase activities
were expressed a relative light emission per bacteria.
Effects of a mutation in ssrB on the secreted effector protein of SPI1 SipC
Analysis of proteins secreted into the growth medium by the S.
typhimurium SPI2 mutant strain MvP320 (non-polar mutation in a, Fig. 1 2)
revealed the absence or strong reduction in the amounts of the secreted
SPI1 effector protein (Hensel et aL, 1997b). These SPI2 mutants are also
reduced in their ability to invade cultured epithelial cells or cultured
macrophages (Hensel et aL, 1997b). To examine this phenomenon in
greater detail, we expressed recombinant SipC (rSipC) and raised antibodies
against rSipC in rabbits. In Western blots, antiserum against rSipC reacted
with a 42 kDa protein from precipitates of culture supernatants of S.
typhimurium wild-type strain NCTC12023. No reaction was observed with
supernatants from cultures of EE638, a strain deficient in SipC (Hueck et
aL, 1995). Furthermore, in Western blots SipC could not be detected in
culture supernatants of the SPI2 mutants MvP320. However, SipC was
detected in culture supernatants of other SPI2 mutants like P2D6
(ssaV::mTn5), P9B6(ssa V/::mTn5) and NPssa V{ssaV::aphT) (Deiwick etal. t
WO 00/1 4240 PCT/EP99/0651 4
- 69 -
1998). The detection by antiserum of SipC in culture supernatants of
various strains was in accord with the presence or absence of SipC as
detected by SDS-PAGE. Further it was analyzed whether the absence of
SipC in culture supernatants of SPI2 mutant strains was due to defective
secretion of SipC via the type III secretion system or reduced synthesis of
SipC in these strains. Antiserum against rSipC was used to detect SipC in
pellets of cultures grown under inducing conditions for the expression of
SPI1 genes (i.e. stationary phase, high osmolarity, low oxygen) (Bajaj etal.,
1 996). Analysis of wild-type and strains carrying various mutations in SPI1
and SPI2 genes indicated highly reduced amounts of SipC in the mutants
with a non-polar mutation in ssrB. However, SipC was detected at levels
comparable to those observed in pellets of wild-type cultures and SPI2
mutant strains P2D6, P9B6 and NPssaV. The effect on SipC synthesis is not
due to reduced growth rates or reduced protein levels in SPI2 mutants,
since both parameters were comparable for the wild-type and SPI2 mutants.
Effects of a mutation in the SPI2 gene ssrB on the expression of SPI1 genes
In order to assay the effect of SP12 mutations on the expression of SPI1
genes, previously characterized fusions of lacZ to various SPI1 genes (Bajaj
et aL, 1995; Bajaj et a/., 1996) were transduced into the SPI2 mutant
MvP320 and various SPI1 mutants to generate a set of reporter fusion
strains. The expression of the reporter S-galactosidase in cultures grown
under conditions inducing for SPI1 expression (see above) was assayed. A
Tn insertion in hi/A (P4H2) reduced the expression of prgK as well as sipC,
while an insertion in spaRS (P6E1 1) only affected the expression of sipC.
Some mutant strains with a mutation in the SPI2 gene ssrB encoding a
components of the two component regulatory system showed reduced
expression of reporter fusions to prgK and sipC (Fig. 11). The effects on the
expression of both genes was similar. Other mutant strains with Tn
WO 00/1 4240 PCT/EP99/0651 4
- 70 -
insertions in ssaV (P2D6 f P9B6), as well as mutant NPsssV harbouring a
non-polar insertions in ssaV, had levels of expression of prgK and sipC
comparable to that of corresponding reporter fusions in a wild-type genetic
background. Analysis of lacZ fusions to prgH and invF revealed a similar
effect on expression as shown for prgK and sipC.
A mutation in the SPI2 gene ssrB affects expression of the SPI1 regulator
hi/A
Analysis of reporter fusions to sipC and prgK indicated that expression of
genes in two different operons of SPI1 can be affected by SPI2 mutations,
suggesting that these mutations affect other SPI1 genes involved in
regulation of sipC and prgK. It has been demonstrated previously that the
expression of SPI 1 genes is under the control of the transcriptional activator
HilA (Bajaj et a/., 1995; Bajaj et aL, 1996). The expression of hi/A was
therefore analyzed in the presence of a SPI2 mutation in ssrB. The SPI2
mutant strain MvP320 had largely diminished levels of hi/A expression.
Again, very low levels of hi/A expression were observed in mutants that had
reduced levels of prgK and sipC expression. To analyze whether the effect
of the SPI2 mutation on sipC expression resulted from the reduced
expression of hi/A, we next performed complementation experiments in
various mutant strains harbouring pVV1 35 (constitutive expression of hi/A)
(Bajaj et a/., 1 996) or p VV2 1 4 (expression of hi/A from the native promoter)
(Bajaj eta/. t 1995). In accordance with a previous study (Bajaj eta/., 1 995),
the hi/A mutation of strain P4H2 was complemented by pVV21 4. However,
the sipC expression was not restored in the mutant strain MvP320
harbouring either pVV135 or pVV214.
WO 00/1 4240 PCT/EP99/0651 4
- 71 -
Construction of the ssrA and ssrB mutant S.typhimurium strains MvP284
and MvP320
Mutant MvP284, ssrA. The ssrA gene (Fig. 1 2) was subcloned from
the phage clone A2 derived plasmid p2-2 on a 5.7kb BamH\ fragment
in pUC18 as indicated in Table 1. A 1.6kb fragment was recovered
after HindlH and EcoRV digestion of p2-2 and subcloned in
A//>?dlll//y/>7cll-digested pBluescript II KS + . The resulting construct
termed p2-20 was digested with HinoW and dephosphorylated with
alkaline phosphatase. The aphT cassette was isolated as described
above and ligated to the linearized plasmid p2-20 in the same
orientation into the unique HinoW site. After transformation of E. coli
XL-1 Blue and selection against kanamycin and carbenicillin {50 pg/m\
each) one clone has been chosen and the harbouring plasmid
isolated. This plasmid was termed p2-21 and its identity proved via
restriction analysis. p2-21 was further digested with Kpn\ and Xba\,
a 2.5kb fragment isolated and ligated to Kpn\/Xba\~d\gested pKAS32.
This plasmid was electroporated into E. coli CC118 Apir and
transformants selected to kanamycin and carbenicillin (50 pglm\
each). As done before, one clone was chosen, its plasmid with the
according DNA fragment in pKAS32, termed p2-22, isolated and
confirmed by restriction analysis. Plasmid p2-22 was electroporated
into £. coli S17-1 Apir and transferred into S. typhimurium
NCTC12023 (streptomycin resistant) by conjugation as has been
described previously (de Lorenzo and Timmis, 1994). Exconjugants
in which the ssrA gene had been replaced by the cloned gene
disrupted by insertion of the aphT cassette were selected by its
growth on M9 + glucose minimal medium agar plates (Maloy era/.,
1996) and its resistance to kanamycin and carbenicillin (100/yg/ml).
The resulting exconjugants were finally shown to have a lactose
negative phenotype and to be sensitive to kanamycin and
streptomycin. Selected clones were further examined by Southernblot
WO 00/14240 PCT/EP99/06514
- 72 -
analysis. In order to exclude possible mutations which might have
been developed during the cloning procedure the mutated ssrA allele
was transfered into a fresh Salmonella background by P22
transduction (described by Maloy et aL, 1996). The resulting
Salmonella strain MvP284 was examined for the presence of the
resistance cassette within the ssrA gene by the use of primers ssrA-
For (5'- AAG GAA TTC AAC AGG CAA CTG GAG G-3') and ssrA-
Rev (5- CTG CCC TCG CGA AAA TTA AG A TAA TA -3').
Amplification of DN A from clones containing the wild-type ssrA allele
resulted in a PCR product of 2800 bp, use of DNA from clones
harbouring a ssrA allele disrupted by the aphT cassette resulted in a
PCR product of 3750bp. The resulting Salmonella strain MvP320 was
examined for the presence of the resistance cassette within the ssrB
gene by the use of Southern hybridization analysis of total DNA of
exconjugants.
Mutant MvP320, ssrB. The ssrB gene (Fig. 1 2) was subcloned from
the phage clone A\ derived plasmid p1-6 on a 4.8kb Pst\IBamH\-
fragment in pT7-Blue as indicated in Table 1 . A 1 .7kb fragment was
recovered after BamH\ and HincW digestion of pl-6 and subcloned in
£a/7?HI/M/7cll-digested pBluescript II KS-f . The resulting construct
termed p1-20 was digested with FcoRV and dephosphorylated with
alkaline phosphatase. The aphT cassette was isolated as described
above and ligated to the linearized plasmid p1-20 in the same
orientation into the unique EcoHV site. After transformation of E. coli
XL-1 Blue and selection against kanamycin and carbenicillin (50/ig/ml
each) one clone has been chosen and the harbouring plasmid
isolated. This plasmid was termed p1-21 and its identity confirmed
by restriction analysis, pi -21 was further digested with Kpn\ and
Xba\, a 2.5kb fragment isolated and ligated to /Cpnl/Xjbal-digested
pKAS32. This plasmid was electroporated into E. cofiCCI 18Ap/rand
transformed bacteria selected to kanamycin and carbenicillin (50
00/1 4240 PCT/EP99/0651 4
- 73 -
jyg/rnl each) was performed. As done before, one clone was chosen,
its plasmid with the according DNA fragment in pKAS32, termed p1-
22^ isolated and confirmed by restriction analysis. Plasmid p1 -22 was
electroporated into E. co/i S17-1 Apir and transferred into S.
typhimurium NCTC1 2023 (streptomycin resistant) by conjugation as
has been described previously (de Lorenzo and Timmis, 1994).
Exconjugants in which the ssrB gene had been replaced by the
cloned gene disrupted by insertion of the aphT cassette were
selected by its growth on M9 + glucose minimal medium agar plates
(Maloy eta/., 1996) and its resistance to kanamycin and carbenicillin
(100 //g/ml). The resulting exconjugants were finally shown to have
a lactose negative phenotype and to be sensitive to kanamycin and
streptomycin. Selected clones were further examined by Southernblot
analysis. In order to exclude possible mutations which might have
been acquired during the cloning procedure the mutated ssrB allele
has been transferred into a fresh Salmonella background by P22
transduction (described by Maloy et al. r 1 996). Screening of mutants
with a insertion of the aphT cassette within the ssrB locus was
performed by PCR using primers ssrB-For (5'- CTT AAT TTT CGC
GAG GG -3') and ssrB-Rev (5'- GGA CGC CCC TGG TTA ATA -3').
Amplification of DNA from clones containing the wild-type ssrB allele
resulted in a PCR product of 660 bp, use of DNA from clones
harbouring a ssrB allele disrupted by insertion of the aphT cassette
resulted in a PCR product of 1 600 bp. The resulting Salmonella strain
MvP320 was examined for the presence of the resistance cassette
within the ssrB gene by the use of Southern hybridization analysis of
, total DNA of exconjugants.
WO 00/1 4240 PCT/EP99/0651 4
- 74 -
Construction of the mutant strain MvP340 carrying an in-frame deletion in
ssrA
A deletion of 407 codons between codon 44 and 451 of ssrB was
generated. Plasmid p2-2 was digested by BamHl and Kpn\, a fragment of
3.7kb was recovered and subcloned in pBIuescript KS-h to generate p2-50.
Plasmid p2-50 was linearized by digestion with Pst\, which cuts once within
the subcloned fragment of the ssrA gene. Primers ssr/i-del-1 (5'- GGT CTG
CAG GAT TTT TCA CGC ATC GCG TC -3') and ssr£-del-2 (5'- GGT CTG
CAG AAC CAT TGA TAT ATA AGC TGC -3') were designed to introduce
Pstl sites. PCR was performed using linearized p2-50 as template DNA. The
TaqPlus polymerase (Stratagene) was used according to the instructions of
the manufacturer. Reactions of 100 pi volume were set up using 10 p\ of
1 0 x TaqPlus Precision buffer containing magnesium chloride, 0.8 //I of 1 00
mM dNTPs, 250 ng DNA template (linearized p2-50), 250 ng of each primer
and 5 U of TaqPlus DNA polymerase. PCR was carried out for 35 cycles of:
95°C for 1 minute, 60°C for 1 minute, 72°C for 6 minutes. Then a final
step of 72°C for 10 minutes was added. 10 p\ of the PCR reaction were
analyzed. A product of the expected size was recovered, digested by Pst\,
self-ligated, and the ligation mixture was used to transform E. coli DH5a to
resistance to carbenicillin. Plasmids were isolated from transformants and
the integrity of the insert and the deletion was analyzed by restriction
analysis and DNA sequencing. The insert of a confirmed construct was
isolated after digestion with Xba\ and Kpn\ and ligated to Xba\/Kpn\-
digested vector pKAS32. The resulting construct was used to transform £.
coli S1 7-1 Ap/r to resistance to carbenicillin, and conjugational transfer of
the plasmid to S. typhimurium (Nal R , Strep R ) was performed according to
standard procedures (de Lorenzo and Timmis, 1 994). Exconjugants that had
integrated the suicide plasmid by homologous recombination were selected
by resistance to nalidixic acid and carbenicillin, and screened for sensitivity
to streptomycin. Such clones were grown in LB to OD600 of about 0.5 and
aliquots were plated on LB containing 250 pg/m\ streptomycin to select for
WO 00/14240 PCT/EP99/06514
- 75 -
colonies which had lost the integrated plasmid and undergone allelic
exchange. Clones resistant to streptomycin but sensitive to carbenicillin
were used for further analysis. Screening of mutants with a deletion within
the ssrA locus was performed by PCR using primers ssrA-For (5'- AAG GAA
TTC AAC AGG CAA CTG GAG G-3') and ssrA-Rev (5- CTG CCC TCG CGA
AAA TTA AGA TAA TA -3'). Amplification of DNA from clones containing
the wild-type ssrA allele resulted in a PCR product of 2800 bp, use of DNA
from clones harbouring a ssrA allele with an internal deletion resulted in a
PCR product of 1580 bp. The integrity of clones harbouring the ssrA
deletion was further confirmed by Southernanalysis of the ssrA locus.
Finally, the ssrA locus containing the internal in-frame deletion was moved
into a fresh strain background of S. typhimurium by P22 transduction
{Maloy et aL, 1996) and the resulting strain was designated MvP340.
Southern hybridization
Genomic DNA of Salmonella was prepared as previously described (Hensel
et aL, 1997). For Southern hybridization analysis, genomic DNA was
digested with EcoRI or EcoRV, fractionated on 0.6 % agarose gels and
transferred to Hybond N + membranes (Amersham, Braunschweig). Various
probes corresponding to the ssrA and ssrB region were obtained as
restriction fragments of the subcloned insert of /U and A2.
Example 9 : Evaluation of safety of S. typhimurium strain MvP320
For competition assays between S. typhimurium wild-type and the mutant
strain MvP320, bacteria were grown in LB to an optical density at 600 nm
of 0.4 - 0.6. Cultures were diluted and aliquots of the two cultures were
mixed to form an inoculum containing equal amounts of both strains. The
ratio of both strains was determined by plating dilutions on LB plates
containing antibiotics selective for individual strains. An inoculum of about
WO 00/1 4240 PCT/EP99/0651 4
- 76 -
10 4 colony forming units (cfu) was used to infect 6 to 8 weeks old female
BALB/c mice (Charles River Breeders, Wiga) by injection into the peritoneal
cavity. At several time points after infection mice were sacrificed by
cervical dislocation and the bacterial load of liver and spleen was
determined by plating tissue homogenates using the 'WASP' (Meintrup,
Lahden) spiral plating device. Plating was performed using LB plates
containing 50/yg/ml kanamycin or 100//g/ml nalidixic acid to select for the
mutant strains or the wild-type, respectively.
Strain MvP320 harbouring the aphT gene cassette in ssrB was recovered
in at least 1000-fold lower numbers than the S. typhimurium wild-type-
strain. These data indicate that ssrB contributes significantly to systemic
infections of S„ typhimurium in the mouse model of salmonellosis.
Statistical analysis of all experiments.
Statistical significance between paired samples was determined by
Student's t test. The significance of the obtained results was determined
using the statgraphic plus for windows 2.0 software (Statistical Graphic
Corp.).
Example 10: Characterization of the in vivo inducible P ssaE Promoter
(Promoter B, Fig.24B)
The promoter which is located upstream of ssaE (P ssaE , formerly called
Promoter B) was shown to be regulated by the ssrAB locus. A DNA
fragment comprising nucleotide 800 to 120 (800-1205) in the included
sequence (Fig. 21 A) was shown to confer ssr£-dependent regulation upon
the expression of a reporter gene (gfp) fused to the promoter. The DNA
fragment was cloned on a low-copy plasmid in front of the gfp gene. As has
been shown previously for other reporter gene constructs, induction of
WO 00/1 4240 PCT/EP99/0651 4
- 77 -
expression from P SS8 e
(800-1205) was observed in magnesium minimal
medium (Deiwick et aL, 1999) and was dependent on the presence of a
chromosomal wild type allele of ssrB. A shorter DNA fragment, comprising
nucleotide 923 to 1205 (923-1205) in the included sequence, did not
confer regulation upon expression of gfp. However, expression was reduced
compared to the P ssaE (800-1205) fragment and was not induced in
magnesium minimal medium nor was it dependent on ssrB. Thus, the P ssaE
(800-1 205) fragment comprises promoter active and regulatory sequences,
probably including an SsrB-binding site.
WO 00/14240
- 78 -
D scription of the drawings
PCT/EP99/06514
Fig. 1 . Map of Salmonella Pathogenicity Island 2 (A) indicating the positions
of the mutations in strains MvP101, MvP102, and MvP103 (B). A partial
restriction map of the genomic region is shown, and the positions of
plasmid inserts relevant for this work are indicated (C). B p BamYW; C, Clal;
E, EcoRl; P, Pstl; V, fcoRV; S, Smal; EMBL database accession numbers
are indicated for the sequences in (A).
Fig. 2a. Alignment of the deduced SseB amino acid sequence to EspA of
EPEC (Elliot et aL, 1998). The ClustalW algorithm of the MacVector 6.0
program was used to construct the alignments. Similar amino acid residues
are boxed, identical residues are boxed and shaded.
Fig. 2b. Alignment of the deduced SseC amino acid sequence to EspD of
EPEC (Elliot etaL, 1 998), YopB of Yersinia enteroco/itica fHakansson et aL,
1993A and PepB of Pseudomonas aeruinosa (Hauser et aL, 1998). The
ClustalW algorithm of the MacVector 6.0 program was used to construct
the alignments. Positions where at least three amino acid residues are
similar are boxed, where at least three residues are identical are boxed and
shaded.
Fig. 3. Intracellular accumulation of S. typhimurium SPI2 mutants in RAW
264.7 macrophages. Following opsonization and infection, macrophages
were lysed and cultured for enumeration of intracellular bacteria (gentamicin
protected) at 2 h and 16 h post-infection. The values shown represent the
fold increase calculated as a ratio of the intracellular bacteria between 2 h
and 16 h post-infection. Infection was performed in in triplicates for each
strain and the standard error from the mean is shown.
WO 00/1 4240 PCT/EP99/0651 4
- 79 -
Fig. 4. Intracellular survival and replication of SPI2 mutant S. typhimurium
in (A) J774.1 cells and (B) periodate-elicited peritoneal macrophages from
C3H/HeN mice. After opsonization and internalization, phagocytes were
lysed and cultured for enumeration of viable intracellular bacteria at time 0
h. The values shown represent the proportion of this intracellular inoculum
viable at 20 h jf the standard error of the mean. Samples were processed
in triplicate, and each experiment was performed at least twice.
Fig. 5. (J-gal-specific antibodies in intestinal lavages of mice orally
immunized with either MvPIOI [pAH97], MvP103 [pAH97], SL7207
[pAH97] or MvP101 at day 52 after immunization. Results are expressed
as percentage of the corresponding total Ig subclass present in the intestinal
lavage, the SEM is indicated by vertical lines. Significant levels of antigen-
specific IgM could not be detected in any of the groups. The results
obtained with MvP103 and SL7207 (not shown) were similar to those for
MvP101.
Fig. 6. ^-gal-specific proliferative response of CD4 + enriched spleen cells
from mice orally immunized with either MvP101 [pAH97], MvP103
lpAH97], SL7207 [pAH971 or MvP101. Cells were restimulated in vitro
during a 4 day incubation with different concentrations of soluble /?-gal. The
values are expressed as mean cpm of triplicates; the SEM was in all cases
lower than 10%. Background values obtained from wells without the
stimulating antigen were subtracted. Results obtained with MvP103 and
SL7207 (not shown) were similar to those obtained with MvP101.
Fig. 7. IFN-k present in supernatants from cultured CD4 + enriched spleen
cells of mice orally immunized with either MvP101 [pAH97), MvP103
|pAH97J, SL7207 (pAH97) or plasmidless MvPIOI at day 2 and 4 of
culture. Spleen cells were isolated from mice at day 52 after immunization,
and CD4+ enriched populations were restimulated in vitro for four days in
the presence of soluble /?-gal (20 ^/g/ml). IFN-y production was determined
WO 00/1 4240 PCT/EP99/0651 4
- 80 -
by ELISA, results represent the means of three determinations. The SEM is
indicated by vertical lines, similar results were obtained using any of the
plasmidless carriers (not shown). No significant differences with the control
groups were observed when IL-2, IL-4, IL-5, IL-6 and IL-1 0 were tested (not
shown).
Fig. 8. Kinetics of the /?-gal-specific serum IgG (closed symbols) and IgM
(open symbols) antibody responses in mice (n = 5) after oral immunization
with either MvP101 [pAH971 (triangle), MvP103 [pAH97] (circle), SL7207
[pAH97] (square) or plasmidless MvP101 (diamond). Results are expressed
as the reciprocal log 2 of the geometric mean end point titer (GMT), the SEM
was in all cases lower than 10%. Similar results were obtained using any
of the plasmidless carriers (not shown), immunizations are indicated by
arrows.
Fig. 9. Subclass profiles of the >S-gal-specific IgG antibodies present in the
serum of mice (n = 5) orally immunized with either MvP10l [pAH97],
MvP103 [pAH97], SL7207 [pAH97] or plasmidless MvPlO! at day 52 post-
immunization. Results are expressed as ng/ml, the SEM is indicated by
vertical lines. Similar results were obtained using any of the plasmidless
carriers (not shown).
Fig. 10. Recognition of the MHC class l-restricted /?GP1 epitope by
lymphocytes primed in vivo in mice by oral vaccination with either MvP101
[pAH97], MvP103 [pAH971, SL7207 |pAH97] or plasmidless MvP101.
Spleen cells from immunized mice were restimulated in vitro five days in the
presence of 20 jjM /?GP1. At the end of the culture, lymphocytes were
tested in a l 3 H]-thymidine-release assay using P815 (open symbols) and
/?GP1 -loaded P81 5 (closed symbols) as targets. Results are mean values of
triplicate wells (one out of three independent experiments is shown) and are
expressed as: [(retained cpm in the absence of effectors) - (experimentally
retained cpm in the presence of effectors) / retained cpm in the absence of
WO 00/1 4240 PCT/EP99/0651 4
- 81 -
effectors] x 100; SEM were lower than 5% of the values. Similar results
were obtained using any of the plasmidless carriers (not shown).
Fig. 11. Expression of an sseA::luc fusion in wild-type and mTn5 mutant
strains of S. typhimurium.
Fig. 12. Map of Salmonella Pathogenicity Island 2 (A) indicating the
positions of the mutations in strains MvP284 and MvP320 (B). A partial
restriction map of the genomic region is shown, and the position of inserts
of plasmids relevant for this work is indicated (C). B, BamHV, C, Clal; H,
H/ndlW; P, Pst\; V; S, Sma\; EcoRV; II, HfncU.
Fig. 13. Model for the transcriptional organization of SPI2 virulence genes.
This model is based on the observation of the transcriptional direction of
SPI2 genes, characterization of promoter activities
Fig. 14 shows the principle of how mutations having a different grade of
attenuation can be generated. As shown in A, the inactivation of one
effector gene such as sse results in a low grade of attenuation. As shown
in B, the additional inactivation of a gene located outside the SPI2 locus
such as aroA results in a medium grade of attenuation. By insertional
mutation with a polar effect all genes in a polycistronic cluster are affected
which results in a high grade of attenuation, as shown in C. As shown in
D, the inactivation of a regulatory gene such as ssrB results in a supreme
attenuation.
Fig. 1 5 shows the principle of insertional mutation by example of insertional
mutation into a virulence gene. Different cassettes such as SMC, GEC, TC
and/or invertase cassette may be inserted into a cloned virulence gene, thus
yielding an inactivated virulence gene which may be introduced into a cell
by homologous recombination using a virulence gene cassette.
WO 00/14240
- 82 -
Fig. 16 illustrates the selective marker cassette.
PCT/EP99/06514
Fig. 17 illustrates the gene expression cassette and the induction thereof in
a two-phase system. The gene expression cassette comprises a promoter,
optionally a gene cassette comprising one or more expression units and
optionally one or more transcriptional terminators for the expression units
and/or a transcribed sequence 5' to the gene expression cassette.
Fig. 1 8 shows the structural requirements of the gene expression unit for the
delivery of heterologous antigens into various compartments, i.e. accessory
sequences that direct the targeting of the expression product.
Fig. 19 shows a transactivator cassette in a one-phase system and a two-
phase system.
Fig. 20 shows different modes of gene expression as realized by the
combination of different accessory sequences and/or cassettes in a one-
phase system and a two-phase system.
Fig.21A shows the genomic sequence of a region of the SPI2 locus from
Salmonella comprising the complete sequences of the genes ssaE to ssal
and partial sequences of ssaD and ssaJ (cf. Fig. 12).
Fig. 21 B shows the nucleotide sequence of a region of the SPI2 locus from
Salmonella comprising the coding sequences for ssrA and ssrB.
Figs.22A-Q each show the nucleotide sequence of the respective gene
indicated.
Figs.23A-Q each show the amino acid sequence of the respective
polypeptide indicated.
WO 00/14240 PCT/EP99/06514
- 83 -
Figs.24A,B each show a nucleotide sequence comprising an in vivo
inducible promoter.
WO 00/14240
PCT/EP99/06514
- 84 -
SEQUENCE LISTING
SEQ ID NO: 1
genomic region
nucleic acid
FIG 21A
5
SEQ ID NO: 2
genomic region
nucleic acid
FIG 21B
SEQ ID NO: 3
sseA
nucleic acid
FIG 22A
SEQ ID NO: 4
sseA
translation product
FIG 23A
SEQ ID NO: 5
sseB
nucleic acid
FIG 22B
SEQ ID NO: 6
sseB
translation product
FIG 23B
10
SEQ ID NO: 7
sseC
nucleic acid
FIG 22C
SEQ ID NO: 8
sseC
translation product
FIG 23C
SEQ ID NO: 9
sseD
nucleic acid
FIG 22D
SEQ ID NO: 10
sseD
translation product
SEQ ID NO: 1 1
sseD
protein
FIG 23D
15
SEQ ID NO: 12
sseE
nucleic acid
FIG 22E
SEQ ID NO: 13
sseE
translation product
FIG 23E
SEQ ID NO: 14
sseF
nucleic acid
FIG 22F
SEQ ID NO: 15
sseF
translation product
FIG 23F
SEQ ID NO: 16
sseG
nucleic acid
FIG 22G
20
SEQ ID NO: 17
sseG
translation product
FIG 23G
SEQ ID NO: 18
sseA
nucleic acid
FIG 22H
SEQ ID NO: 19
sseA
translation product
FIG 23H
SEQ ID NO: 20
sseB
nucleic acid
FIG 221
SEQ ID NO: 21
sseB
translation product
FIG 231
25
SEQ ID NO: 22
ssaD
nucleic acid
FIG 22J
SEQ ID NO: 23
ssaD
translation product
FIG 23J
SEQ ID NO: 24
ssaE
nucleic acid
FIG 22K
SEQ ID NO: 25
ssaE
translation product
FIG 23K
SEQ ID NO: 26
ssaG
nucleic acid
FIG 22L
30
SEQ ID NO: 27
ssaG
translation product
FIG 23L
SEQ ID NO: 28
ssaH
nucleic acid
FIG 22M
SEQ ID NO: 29
ssaH
translation product
FIG 23M
SEQ ID NO: 30
ssal
nucleic acid
FIG 22N
SEQ ID NO: 31
ssal
translation product
FIG 23N
35
SEQ ID NO: 32
ssaJ
nucleic acid
FIG 220
SEQ ID NO: 33
ssaJ
translation product
FIG 230
SEQ ID NO: 34
ssrA
nucleic acid
FIG 22P
SEQ ID NO: 35
ssrA
translation product
FIG 23P
SEQ ID NO: 36
ssrB
nucleic acid
FIG 22Q
40
SEQ ID NO: 37
ssrB
translation product
FIG 23Q
SEQ ID NO: 38
Promoter A2
nucleic acid
FIG 24A
SEQ ID NO: 39
Promoter B
nucleic acid
FIG 24B
SEQ ID NO: 40
Esp A
protein
FIG 2A
SEQ ID NO: 41
Esp D
protein
FIG 2B
45
SEQ ID NO: 42
Yop B
protein
FIG 2B
SEQ ID NO: 43
Pep B
protein
FIG 2B
SEQ ID NO: 44
D89
nucleic acid
page 33
SEQ ID NO: 45
1)90
nucleic acid
page 33
WO 00/14240
PCT/EP99/06514
SEQ ID NO: 46 D91
SEQ ID NO: 47 D92
SEQ ID NO: 48 E25
SEQ ID NO: 49 E28
5 SEQ ID NO: 50 E6
SEQ ID NO: 51 E4
SEQ ID NO: 52 sseC-dell
SEQ ID NO: 53 sseE-dell
SEQ ID NO: 54 sseC-For
10 SEQ ID NO: 55 sseC-Rev
SEQ ID NO: 56 sseD-dell
SEQ ID NO: 57 sseD-del2
SEQ ID NO: 58 sseD-For
SEQ ID NO: 59 sseD-Rev
15 SEQ ID NO: 60 sscB-dell
SEQ ID NO: 61 sscB-del2
SEQ ID NO: 62 sscB-For
SEQ ID NO: 63 sscB-Rev
SEQ ID NO: 64 ssrA-For
20 SEQ ID NO: 65 ssrA-Rev
SEQ ID NO: 66 ssrB-For
SEQ ID NO: 67 ssrB-Rev
SEQ ID NO: 68 ssrA-dell
SEQ ID NO: 69 ssrB-del2
25
- 85 -
nucleic acid
page 33
nucleic acid
page 33
nucleic acid
A 1
page 41
nucleic acid
A \
page 41
nucleic acid
page 42
nucleic acid
page 43
nucleic acid
page 44
nucleic acid
A A
page 44
nucleic acid
A C
page 45
nucleic acid
A C
page 45
nucleic acid
page 45
nucleic acid
page 45
nucleic acid
page 46
nucleic acid
page 46
nucleic acid
page 47
nucleic acid
page 47
nucleic acid
page 47
nucleic acid
page 47/45
nucleic acid
page 66
nucleic acid
page 66
nucleic acid
page 67
nucleic acid
page 67
nucleic acid
page 67
nucleic acid
page 68
WO 00/14240
- 86 -
PCT/EP99/06514
Literature
Bajaj, V., Lucas, R.L., Hwang, C, Lee, C.A. (1996). Co-ordinate regulation
of Salmonella typhimurium Invasion genes by environmental and regulatory
factors is mediated by control of expression. MoL MicrobioL 22: 703-71 4.
Bajaj, V., Hwang, C, Lee, C.A. (1995). hi/A is a novel ompR/toxR family
member that activates the expression of Salmonella typhimurium invasion
genes. MoL MicrobioL 18: 715-727.
Baudry, B., Kaczorek, M. and Sansonetti, P.J. (1988) Nucleotide sequence
of the invasion plasmid antigen B and C genes (ipaB and ipaC) of Shigella
f/exnerL Microb Pathog 4: 345-357.
Bogdanove, A.J., Beer, S.V., Bonas, U., Boucher, C. A., Collmer, A.,
Coplin, D.L., Cornelis, G. R., Huang, H.-C, Hutcheson, S.W., Panopoulos,
N.J., and van Gijsegem, F. (1996) Unified nomenclature for broadly
conserved hrp genes of phytopathogenic bacteria. Mol Microbiol 20: 681-
683.
Buchmeier, N.A., Lipps, C.J., So, M.Y.H., Heffron, F. (1993)
Recombination-deficient mutants of Salmonella typhimurium are avirulent
and sensitive to the oxidative burst of macrophages. MoL MicrobioL 7: 933-
936
Chang, A.C. and Cohen, S.N. (1978). Construction and characterization of
amplifiable multicopy DNA cloning vehicles derived from the PI 5A cryptic
miniplasmid. J Bacterid 134: 1 141-1 1 56.
Cirillo, D. M., Valdivia, R. H., Monack, D. M., Falkow, S. (1998)
Macrophage-dependent induction of the Salmonella pathogenicity island 2
WO 00/1 4240 PCT/EP99/065 1 4
- 87 -
type III secretion system and its role in intracellular survival. Mol. Microbiol.
30: 175 88
Cirillo, J.D., Stover, C.K., Bloom, B.R., Jacobs, W.R.Jr., Barletta, R.G.
(1 995). Bacterial vaccine vectors and bacillus Calmette-Guerin. Clin. Infect.
Dis. 20: 1001-1009.
DeGroote, M.A., Ochsner, U.A., Shiloh, M.U., Nathan, C, McCord, J.M.,
Dinauer, M.C., Libby, S.J., Vazquez-Torres, A., Xu, Y., and Fang, F.C.
{ 1 997) Periplasmic superoxide dismutase protects Salmonella from products
of phagocyte NADPH-oxidase and nitric oxide synthase. Proc Natl Acad Sci
USA 94: 13997-14001.
de Lorenzo, V. and Timmis, K.N. (1994). Analysis and construction of
stable phenotypes in Gram-negative bacteria with Tn5-and TnlO-derived
minitransposons. Methods EnzymoL 235, 386-405.
Devereux, J., Haeberli, P., and Smithies, O. (1984) A comprehensive set of
sequence analysis programs for the VAX. Nucleic Acids Res 12: 387-395.
Deiwick, J., Nikolaus, T., Erdogan, S., Hensel, M. (1999). Environmental
regulation of Salmonella pathogenicity island 2 gene expression. Mol.
Microbiol. 31: 1759-1773.
Deiwick, J., Nikolaus, T., Shea, J.E., Gleeson, C, Holden, D.W., Hensel,
M. (1998). Mutations in SPI2 genes affecting transcription of SPI1 genes
and resistance to anti-microbial agents. J. Bacterid. 180: 4775-4780.
Donnenberg, M.S., and Kaper, J.B. (1 991 ) Construction of an eae deletion
mutant of enteropathogenic Escherichia colt using a positive-selection
suizide vector. Infect Immun 59: 4310-4317
WO 00/14240 PCT/EP99/06514
- 88 -
Elliot, S.J., Wainwright, L.A., McDaniel, T.K., Jarvis, K.G., Deng, Y.K., Lai.,
L.C., McNamara, B.P., Donnenberg, M.S., and Kaper, J.B. (1998) The
complete sequence of the locus of enterocyte affacement (LEE) from
enteropathogenic Escherichia co/i E2348/69. Mo/ Microbiol 28: 1-4.
Fields, P.L, Swanson, R.V., Haidaris., C.G., and Heffron, F. (1986) Mutants
of Salmonella typhimurium that cannot survive within the macrophage are
avirulent. Proc Natl Acad Sci USA 83: 51 89-51 93.
Forsberg, A., Pavitt, G.D. and Higgins, C.F. (1994). Use of transcriptional
fusions to monitor gene expression: a cautionary tale. J.Bacteriol. 176:
2128-2132.
Galan, J.E., Ginocchio, C. and Costeas, P. (1 992). Molecular and functional
characterization of the Salmonella invasion gene invA: homology of InvA to
members of a new protein family. J.Bacteriol, 174: 4338-4349.
Gentschev, L, Glaser, I., Goebel, W., McKeever, D.J., Musoke, A., and
Heussler, V.T. (1998) Delivery of the p67 sporozoite antigen of Theileria
parva by using recombinant Salmonella dub/in: secretion of the product
enhances specific antibody responses in cattle. Infect Immun 66: 2060-
2064.
Gunn, J.S., Miller, S.I. (1996). PhoP-PhoQ activates transcription of pmrAB,
encoding a two-component regulatory system involved in Salmonella
typhimurium an\\vc\\cxob\a\ peptide resistance. J. BacterioL 178: 6857-6864.
Hakansson, S., Schesser, K., Persson, C, Galyov, E.E., Rosqvist, R.,
Homble, F., and Wolf Watz, H. (1996) The YopB protein of Yersinia
pseudotuberculosis is essential for the translocation of Yop effector proteins
across the target cell plasma membrane and displays a contact-dependent
membrane disrupting activity. EMBO J 15: 5812-5823.
WO 00/1 4240 PCT/EP99/0651 4
- 89 -
Harlow, E., Lane, D. (1988). Antibodies: A laboratory manual. Cold Spring
Harbour Laboratory Press, Cold Sprin Harbour, New York.
Hauser, A.R., Fieiszig, S., Kang, P.J., Mostov, K., and Engel, J.N. (1998)
Defects in type III secretion correlate with internalization of Pseudomonas
aeruginosa by epithelial cells. Infect Immun 66: 1413-1420.
Heithoff, D.M., Sinsheimer, R.L., Low, D.A., and Mahan, M.J. (1999) An
essential role for DNA adenine methylation in bacterial virulence. Science
284: 967-970.
Hensel, M., Nikolaus, T., Egelseer, C. (1999). Molecular and functional
analysis indicates a mosaic structure of Salmonella Pathogenicity Island 2.
MoL Microbiol. 31: 489-98.
Hensel, M., Shea, J.E., Baumler, A.J., Gleeson, C, and Holden, D.W.
( 1 997a) Analysis of the boundaries of Salmonella pathogenicity island 2 and
the corresponding chromosomal region of Escherichia coli K-1 2. J Bacteriol
179: 1105-1111.
Hensel, M., Shea, J.E., Raupach, B., Monack, D., Falkow, S., Gleeson, C,
and Holden, D.W. (1997b) Functional analysis of ssaJ and the ssaK/U
operon, 1 3 genes encoding components of the type III secretion apparatus
of Salmonella pathogenicity island 2. Mof Microbiol 24: 155-167.
Hensel, M., Shea, J.E., Gleeson, C, Jones, M.D., Dalton, E., Holden, D.W.
(1 995). Simultaneous identification of bacterial virulence genes by negative
selection. Science 269: 400-403.
Herrero, M., de Lorenzo, V., and Timmis, K.N. (1990) Transposon vectors
containing non-antibiotic resistance selection markers for cloning and stable
WO 00/1 4240 PCT/EP99/0651 4
- 90 -
chromosomal insertion of foreign genes in gram-negative bacteria. J
Bacteriol 172: 6557-6567.
Hess, J., Dietrich, G., Gentschev, L, Miko, D. # Goebel, W., and Kaufmann,
S.H. (1997a) Protection against murine listeriosis by an attenuated
recombinant Salmonella typhimurium vaccine strain that secretes the
naturally somatic antigen superoxide dismutase. Infect Immun 65: 1286-
1292.
Hess, J., Gentschev, L, Miko, D., Welzel, M., Ladel, C, Goebel, W., and
Kaufmann, S.H. (1996) Superior efficacy of secreted over somatic antigen
display in recombinant Salmonella vaccine induced protection against
listeriosis. Proc Natl Acad Sci USA 93: 1458-1463.
Hess, J., Miko, D., Gentschev, I., Dietrich, G., Goebel, W. f Mollenkopf,
H.J., Ladel, C, and Kaufmann, S.H. (1 997b) Modulation of antigen display
by attenuated Salmonella typhimurium strains and its impact on protective
immunity against listeriosis. Behring Inst Mitt 1 60-1 71 .
Hofmann, K. and Stoffel, W. (1993). TMbase - a database of membrane
spanning proteins segments. Biol Chem Hoppe-Seyler 347: 166.
Holtel, A., Timmis, K.N., Ramos, J.L. (1 992). Upstream binding sequences
of the XylR activator protein and integration host factor in the xy/S gene
promoter region of the Pseudomonas TOL plasmid. Nucleic. Acids. Res.
20:1755-1762.
Hueck, C. J. (1998). Type III protein secretion systems in bacterial
pathogens of animals and plants. Microbiol. Mol. Biol. Rev. 62: 379-433.
WO 00/1 4240 PCT/EP99/0651 4
- 91 -
Hueck, C.J., Hantman, M.J., Bajaj, V., Johnston, C, Lee, C.A., Miller, S.l.
(1995). Salmonella typhimurium secreted invasion determinants are
homologous to Shigella Ipa proteins. MoL Microbiol. 18: 479-490.
Kaniga, K., Tucker, S., Trollinger, D., Galan, J. E. (1995). Homologs of the
Shigella IpaB and IpaC invasins are required for Salmonella typhimurium
entry into cultured epithelial cells. J. BacterioL 177: 3965-3971.
Kuwajima, G., Kawagishi, L, Homma, M., Asaka, J., Kondo, E., and
Macnab, R.M. (1 989) Export of an N-terminal fragment of Escherichia coli
flagellin by a flagellum-specific pathway. Proc Natl Acad Sci USA 86: 4953-
4957.
Laemmli, U.K. (1970). Cleavage of structural proteins during the assembly
of the head of bacteriophage T4. Nature 227: 680-685.
Macnab, R.M. (1996) Flagella and motility. In Escherichia coli and
Salmonella: cellular and molecular biology. F. C. Neidhardt, et aL (eds.).
Washington, D.C.: ASM Press, pp. 123-145
Maloy, S.R., Steward, V.L. and Taylor, R.K. (1996). Genetic analysis of
pathogenic bacteria, Cold Spring Harbor, New York: Cold Spring Harbor
Laboratory Press.
Miller, J.H. (1 992). A short course in bacteria genetics. Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, New York.
Miller, S.L, Kukral, A.M., and Mekalanos, J.J. (1989) A two component
regulatory system iphoP and phoQ) controls Salmonella typhimurium
virulence. Proc Natl Acad Sci USA 86: 5054 5058.
WO 00/1 4240 PCT/EP99/065 1 4
- 92 -
Miller, V.L., Mekalanos, J.J. (1988). A novel suicide vector and its use in
construction of invertion mutations: osmoregulation of outer membrane
proteins and virulence determinants in Vibrio cholerae requires toxR.
J.BacterioL 170, 2575-2583.
Minamino, T., and Macnab, R.M. (1999) Components of the Salmonella
flagellar export apparatus and classification of export substrates. J Bacterid
181: 1388-1394.
Monack, D.M., Raupach, B., Hromockyj, A.E., and Falkow, S. (1996)
Salmonella typhimurium invasion induces apoptosis in infected
macrophages. Proc Natl Acad Set USA 93: 9833-9838.
O'Callaghan, D., Charbit, A. (1990). High efficiency transformation of
Salmonella typhimurium and Salmonella typhi by electroporation. Mol. Gen.
Genet. 223:156-158.
Ochman, H., Soncini, F.C., Solomon, F., Groisman, E.A. (1996).
Identification of a pathogenicity island required for Salmonella survival in
host cells. Proc. Natl. Acad. Sci. USA 93: 7800-7804.
Orr, N., Galen, J.E., and Levine, M.M. (1999) Expression and
immunogenicity of a mutant diphtheria toxin molecule, CRM 197 , and its
fragments in Salmonella typhi vaccine strain CVD 908-htrA. Infect Immun
67: 4290-4294.
Pallen, M.J., Dougan, G., and Frankel, G. (1997) Coiled-coil domains in
proteins secreted by type III secretion systems. Mol Microbiol 2.5: 423-425.
Ralph, P.,Prichard f J., and Cohn, M. (1975). Reticulum cell sarcoma: and
effector cell in antibody-dependent cell-mediated immunity. J. Immunol.
114: 898-905.
WO 00/14240 PCT/EP99/06514
- 93 -
Reed, L.J., Muench, H. (1938). A simple method of estimating fifty per cent
end points. Am. J. Hyg. 27:493-497.
Sambrook, J., Fritsch, E.F., Maniatis, T. (1989). Molecular cloning: a
laboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, New York.
Sanger, F., Nicklen, S., and Coulson, A.R. (1977) DNA sequencing with
chain terminating inhibitors. Proc Natl Acad Sci USA 74: 5463-5467.
Schmitt, C.K., Darnell, S.C., and O'Brien, A.D. (1996) The attenuated
phenotype of a Salmonella typhimurium flgM mutant is related to expression
of FliC flagellin. J Bacterid 178: 291 1-291 5
Shea, J.E., Hensel, M., Gleeson, C, Holden, D.W. (1996). Identification of
a virulence locus encoding a second type III secretion system in Salmonella
typhimurium. Proc. Natl. Acad. Sci. USA 93: 2593-2597.
Skorupski, K. and Taylor, R.K. (1996). Positive selection vectors for allelic
exchange. Gene 169: 47-52.
Valdivia, R.H., and Falkow, S. (1997) Fluorescence-based isolation of
bacterial genes expressed within host cells. Science 277: 2007-201 1.
Valentine, P.J., Devore, B.P., and Heffron, F. (1998) Identification of three
highly attenuated Salmonella typhimurium mutants that are more
immunogenic and protective in mice than a prototypical aroA mutant. Infect
Immun 66: 3378-3383
Wattiau, P., Bernier, B., Destee, P., Michiels, T., and Cornells, G.R. (1994)
Individual chaperones required for Yop secretion by Yersinia. Proc Natl Acad
Sci USA 91: 10493 10497.
WO 00/14240
- 94 -
PCT/EP99/06514
Yanisch-Perron, C. ( Vieira, J. and Messing, J. (1985). Gene 33, 103-119.
Young, G.M., Schmiel, D.H., and Miller, V.L. (1 999) A new pathway for the
secretion of virulence factors by bacteria: the flagellar export apparatus
functions as a protein-secretion system. Proc Natl Acad Sci USA 96: 6456-
6461.
Zhu, N., Liggitt, D., Liu, Y., Debs, R. (1993). Systemic gene expression
after intravenous DNA delivery into adult mice. Science 261: 209-21 1.
Live Music Archive
Librivox Free Audio
Metropolitan Museum
Cleveland Museum of Art
Internet Arcade
Console Living Room
Books to Borrow
Open Library
TV News
Understanding 9/11